SLDB

Speech/Language Disorders Database

Hello Guest! Login | Register

Gene / phenotype associations for DYX1C1

  • Click column headers to sort. Click to expand any row to see more details about the particular assertion of an association between variants of DYX1C1 and a particular phenotypic variable.
  • Click the Pubmed IDs in the last column to link out to the primary research article. Click the links in the last column to download the full Genotype-Phenotype record as JSON or XML formatted text.
Entrez Id Symbol Location Disorder Brief Phenotype Reference Year Download
161582 DYX1C1 15q21.3 Dyslexia Susceptibility to developmental dyslexia Taipale et al 2003 JSON | XML

Conflicting Studies:

  • Bellini et al (2005) - No significant evidence for association between dyslexia and -3G/A and 1249G/T variants in DYX1C1 in Italian population
  • Meng et al (2005) - This study failed to find association between the two most significant EKN1 / DYX1C1 polymorphisms and dyslexia in a cohort of 522 subjects from 150 North American nuclear families
  • Scerri et al (2004) - This study failed to find association between EKN1 / DYX1C1 polymorphisms and dyslexia in a cohort of 1153 individuals in 264 nuclear families in the UK.
  • Marino et al (2005) - This study failed to find association between EKN1 / DYX1C1 polymorphisms and dyslexia or reading-related phonological phenotypes in a sample of 158 families with at least one child with dyslexia
  • Venkatesh et al (2011) - Failed to find significant association between six SNPs in DYX1C1 (including rs57809907) and dyslexia in a population of 50 cases of children with dyslexia and 50 controls in an Indian population
  • Zou et al (2012) - This meta-analysis pooled 734 cases, 1067 controls, and 586 families with genotyping of the -3G>A polymorphism in DYX1C1 identified by Taipale et al. (2003). This polymorphism did not show a significant influence on dyslexia susceptibility.
  • Saviour et al (2008) - Failed to find association between -3G>A and 1249G>T SNPS (as well as two other SNPs) and developmental dyslexia in an Indian population of 52 children with dyslexia and 51 controls.
  • Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

    Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

    References (fourth editions of these tests are also now available):

    Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

    Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

    Basic Study Type:  - Association study - FISH (fluorescent in situ hybridization) - Immunofluorescence (to localize protein within cell) - Brain expression analysis

    Study Cohort: 
    Summary:

    (1) Family segregating a translocation and dyslexia

    (2) 119 individuals (20 families); 3 additional families; 33 additional dyslexic-nondyslexic cojples; 100 anonymous blood donors.


    Details:

    "A family segregating t(2;15)(q11;q21) and dyslexia (5) was studied to identify the translocation breakpoint in chromosome 15q21 as a putative marker involving a gene for dyslexia (Fig. 1A). The phenotypes of the family members have been described in detail (5). In brief, the father had a history of profound reading and writing difficulties in school but is employed in business. The two daughters with translocations have been examined and diagnosed with dyslexia at Helsinki University Hospital after being referred there at ages 7 and 9, respectively, because of reading problems in school. Their brother was referred to a neuropediatric unit at age 6 and was diagnosed with specific difficulty in reading-related skills; however, his overall performance was also slightly below normal. He has attended special education class."

    "For association studies, 58 dyslexic and 61 nondyslexic individuals from 20 unrelated families were first recruited from the Department of Pediatric Neurology at the Hospital for Children and Adolescents, University of Helsinki (Helsinki, Finland). In addition, 3 families and 33 unrelated dyslexic-nondyslexic couples were recruited by the Child Research Centre, Jyva¨skyla¨, Finland. Additional population controls consisted of 100 anonymous blood donors."

    Genotyping Methods: 
    Fluorescent in Situ Hybridization (FISH) and Southern Blotting:

    "RPCI-11 bacterial artificial chromosome (BAC) clone 178D12 (GenBank accession no. AC013355), the yeast artificial chromosome (YAC) clones 770D11, 794F1, 967G2, 757D11, 952C2, and 965E5 from the Centre d’E´ tude du Polymorphisme Humain (CEPH), and the P1 134E18 (Genome Systems, St. Louis) were used as probes in FISH. The methods for FISH have been previously described (5). Samples (15 µg) of total genomic DNA from an individual carrying the translocation and from an unrelated control person were digested with BamHI, EcoRI, HindIII, BsaAI, PstI, or SphI, subjected to electrophoresis in a 0.7% agarose gel, and transferred to Hybond N+ membrane (Amersham Pharmacia Biotech) with alkaline blotting. PCR fragments derived from human genomic DNA were cloned into pCR2.1 TOPO-TA vector (Invitrogen), and the insert was removed with EcoRI digestion and purified by gel electrophoresis (Qiagen, Venlo, The Netherlands). alpha-32P-labeled insert was used as a probe in Southern hybridization. Hybridization was performed overnight at 65°C in 0.5 M NaHPO4/1 mM EDTA/7% SDS/1% BSA, and the filter was washed in 2xSSC/0.05% SDS at 65°C for 1 h. Filters were autoradiographed with a PhosphorImager."

    Cloning of DYX1C1 and Sequence Analysis:

    "Novel genes in the sequence of clone 178D12 were predicted with GENSCAN and FGENES software. Predicted genes were confirmed by sequencing RT-PCR products. Mouse Dyx1c1 was constructed from two overlapping EST sequences (GenBank accession nos. BG242087 and AK005832) and verified by comparing it to all available mouse Dyx1c1 EST sequences. cDNA sequences of Dyx1c1 and DYX1C1 were aligned with CLUSTALX. The alignment was improved manually, and shaded with BOXSHADE. The secondary structure of the T+A-rich region was predicted with MFOLD (available at www.bioinfo.rpi.edu/applications/mfold/old/dna/) with default parameters. Promoter region of DYX1C1 was predicted with the TSSG and TSSW software, available at http://searchlauncher.bcm.tmc.edu//seqsearch/gene-search.html, and neural network promoter prediction (NNPP) software, available at www.fruitfly.org/seq_tools/promoter.html. Transcription factor binding sites were predicted by TESS at www.cbil.upenn.edu/tess, MATINSPECTOR at www.gsf.de/biodv/matinspector.html, and TFSEARCH at www.cbrc.jp/research/db/TFSEARCH.html.


    Polymorphism Detection and Association Analysis:

    "All 10 exons of DYX1C1 were directly sequenced after PCR with intronic primers flanking exons from 20 dyslexic individuals (all primer sequences available from authors on request). Polymorphisms -164C --> T, 4C --> T, and 572G --> A introduced novel Tsp45I, MnlI, and MboII restriction sites, respectively. Because -3G --> A, -2G --> A, 270G --> A, and 1249G --> T changed no restriction sites, a mutation was introduced into the primer sequence to create a restriction site specific for one of the single-nucleotide polymorphism (SNP) alleles: MspI for 3G3A and 2G3A, Bstf5I for 270G 3 A, and HpyCH4 IV for 1249G --> T. In addition, a tail containing the SNP-specific restriction site to act as an internal control for digestion was added to the primer. 1259C --> G was directly sequenced. PCR products were digested with the appropriate enzyme and electrophoresed on agarose gels. 572G --> A was run on a polyacrylamide gel and visualized by silver staining. SNPs -3G --> A and -2G --> A were in the same restriction site and, therefore, individuals showing the A allele after restriction were sequenced to verify which sequence change was present."

    Analysis Methods: 
    For association study:

    "The chi-squared test or Fisher’s exact test was used to evaluate the statistical significance. Bonferroni correction was applied where specified. The transmission disequilibrium test (TDT) was used to assess risk haplotype transmission."

    Other Details: 
    Diagnostic criteria for association study:

    "Normal performance intelligence quotient (PIQ > 85) and remarkable deviation (depending on age, at least 2 years) in reading skills."

    Tests used:

    (1) "Finnish reading and spelling tests designed for children (6) and adults (7) "

    (2) Wechsler tests for adults (WAIS-R; ref. 8) and children (WISC-R; ref. 9), to measure intelligence (Subtests: Information, Digit Span, Vocabulary, Similarities, Picture Completion, Picture Arrangement, Block Design, and Coding)

    (3) Neuropsychological tests (10-13) for reading-related neurocognitive skills (phonological awareness, rapid automatized naming, and verbal short-term memory)

    Expression study:

    "The expression of DYX1C1 was analyzed by RT-PCR from CLONTECH’s multiple-tissue cDNA panels 1 and 2. RT-PCR was performed in 25 µl under the following conditions: 94°C 2 min (94°C 1 min, 68°C 2 min) 30 times, 1 x DyNAzyme buffer with MgCl2 (Finnzymes, Espoo, Finland), 0.2 unit of DyNAzyme II polymerase (Finnzymes), 15 pmol of forward primer GTTGACAGAATGCTGTTCCACGTCG, and 15 pmol of reverse primer CAAGCTGAGGCACGAAGAGCAATGA. For Northern blot analysis, a cDNA probe corresponding to bases 40–630, spanning exons 2–5 of DYX1C1 coding sequence, was hybridized to multiple-tissue Northern blots I and II (CLONTECH) according to the manufacturer’s instructions. The genomic sequences of nonhuman primates corresponding to all exons were determined by direct sequencing after PCR amplification with human-specific intronic primers (primer sequences available from authors on request)."


    Cellular Localization of DYX1C1 Protein:

    "Full-length DYX1C1 cDNA was cloned into pcDNA3.1/V5–6xHis expression vector (Invitrogen). The African green monkey kidney COS-1 cell line was transfected with 3 µg of the construct, with FuGENE 6 (Roche molecular Biochemicals) as a transfection reagent, according to manufacturer’s protocols. Cells were stained with mouse anti-V5 antibody (Invitrogen) and FITC-conjugated goat anti-mouse IgG (Sigma–Aldrich). Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). The specificity of anti-V5 antibody was tested with standard Western blotting methods."

    Immunohistochemical Study of Brain:

    "To investigate whether DYX1C1 is expressed in mature human brain, brain tissue from six deceased individuals was stained with anti-DYX1C1 antiserum raised in rabbits against the peptide CATEAKAAAKREDQK (antibody production purchased from Sigma- Genosys). The patients had died of cardiac arrest or ischemic stroke. In the five individuals with stroke, the postischemic time before death varied from 15 to 60 h, and brain samples were obtained at rapid autopsies with postmortem delays varying from 10 to 40 h. Tissue blocks with cortical and some subcortical tissue were obtained from the core or an area close to the core of the infarction and control samples were dissected from homologous contralateral locations for comparison. Tissues were fixed in formalin and embedded in paraffin, and were used for research by permission of the appropriate Ethical Review Board of the Helsinki University Central Hospital. Immunohistochemical methods and use of this postmortem autopsy material for studies on other proteins have been described (14). The dilutions of antiserum used were 1:100–1:200, and all stained sections were compared with adjacent tissue sections incubated with the preimmune serum in identical conditions and dilutions. No antigen-retrieval methods were used. Light microscopy of tissue sections was performed with Leitz Laborlux D microscope (Leitz, Wetzlar, Germany) equipped with Nikon Coolpix 995 digital camera (Nikon)."

    Associated Markers:
    rs3743205  (P = 0.0020)  - -3G->A
    rs57809907  (P = 0.006)  - 1249 G->T


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Orthographic coding Scerri et al 2004 JSON | XML

    Additional Phenotype Details: May be assessed by a forced word choice test as in Olson et al 1994, requiring "(identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain" (Newbury et al 2011).

    Basic Study Type:  Association study

    Study Cohort: 
    Summary: 264 familes (1153 individuals), each including at least one severely dyslexic child

    "The sample of 264 nuclear families analysed in this study consists of 173 families described in previous reports [10] and an additional set of 91 families similarly ascertained through the dyslexia clinic at the Royal Berkshire Hospital, Reading. The complete sample now contains 1153 individuals, including 630 siblings measured for a series of reading and language related quantitative traits. More than 68% of these families had, in addition to a proband with severe dyslexia, at least one other child with some evidence of reading related problems (for example, based on school history or parental report) [11, 12]. The remaining families (less than 32%) contained at least one severely dyslexic proband without a requirement for reading impairment in an additional sibling, and comprised the majority of the last 91 families ascertained."

    Genotyping Methods: 
    "SNPs were genotyped for all individuals (parents and children) using the MassEXTEND assay from Sequenom, according to the manufacture’s instructions. This technique is based on the analysis of allele specific primer extension products using matrix assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. All individuals were also genotyped for highly polymorphic microsatellite markers by semi-automated fluorescent genotyping techniques, and quality checked as previously described [10,11]. All primer sequences are available on request."

    Analysis Methods: 
    - PEDSTATS used to test for Hardy-Weinberg equilibrium

    - MERLIN to check for genotyping errors and construct most likely haplotypes

    - QTDT (Quantitative Traits Disequilibrium Test)

    - GENEHUNTER (2.1_r2 beta) for multi-point linkage analysis

    Other Details: 
    Phenotypic measures

    "A battery of psychometric tests was administered to each proband, as described in earlier publications [11, 12]. These included standard tests of single word reading (READ) and spelling (SPELL), accompanied by tests aimed at measuring a variety of reading and language related cognitive abilities. Phoneme awareness (PA), defined as the ability to reflect on and manipulate the separate speech units that make up a word, was assessed via performance on a ‘‘spoonerism’’ task. Phonological decoding (PD), the ability to convert a sequence of written symbols into their corresponding phonemes, was measured with a non-word reading test. Orthographic coding (OC), the ability to recognise orthographic representations of whole words and retrieve appropriate phonological representations from a mental lexicon, was assessed with two complementary tests, a forced choice task (OC-choice) and a test involving reading of irregular words (OC-irreg). We have shown previously [12] that these quantitative traits are significantly familial in our UK sample. More details of phenotype measurements, including standardisation methods and descriptive statistics, have been extensively described elsewhere [12, 13]."

    Associated Markers:
    1249GT  (P = 0.0212)  - Allele: G


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Susceptibility to developmental dyslexia Wigg et al 2004 JSON | XML

    Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

    Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

    References (fourth editions of these tests are also now available):

    Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

    Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

    Basic Study Type:  Association study

    Study Cohort: 
    Summary:

    148 families, including 202 probands and siblings (83 probands and 18 siblings diagnosed as dyslexic)

    "Subjects, 6–16 years of age, with evidence of reading problems were recruited for this study from local schools. All siblings in the same age range as the probands, regardless of reading ability, were recruited into the study. . .In total, 148 nuclear families were genotyped for this study; these families include 54 siblings, 120 families with both parents participating, and 28 families where one parent participated. Of the 202 probands and siblings that were recruited for this study, 83 of the probands and 18 of the siblings were classified as having dyslexia, as defined by our diagnostic criteria, and, therefore, were included in the categorical analysis. All the probands and siblings were used for the quantitative analysis."

    Genotyping Methods: 
    "For the analysis, we used the two markers previously reported to be associated with dyslexia, -3G/A (rs3743205) and 1249G/T [37]. . . We genotyped two other markers (-2G/A and +4C/T), but these were not polymorphic in our sample. We therefore searched for all confirmed polymorphisms in public databases and for predesigned and tested assays from Applied Biosystems (ABI, Foster City, CA, USA, Assay-on-Demand by Applied Biosystems®). We identified two markers in the ABI database and two in the NCBI SNP database (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=161582). The markers rs2007494, rs3743204, rs11629841, 1249G/T, and rs692691 were genotyped with the ABI 7900-HT Sequence Detection System® (Applied Biosystems) using the TaqMan 5' nuclease assay for allelic discrimination. Primer and probe sequences and annealing temperatures are listed in Table 3a. Reference sequences for Assay-on-Demand by Applied Biosystems® are also shown in Table 3b. The PCR reactions (10 µl volume) contained 30 ng of genomic DNA, 10 µmol of TaqMan® Universal PCR Master Mix (Applied Biosystems), and 0.25 µl of allelic discrimination mix (Applied Biosystems) containing 36 µM of each primer and 8 µM of each probe. The thermal cycling conditions were 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 94°C for 15 s, and an annealing temperature for 1 min. Each 96-well plate contained two negative controls. Plates were then read on the ABI 7900HT Sequence Detection System (SDS) using the allelic discrimination end-point analysis mode of SDS software package version 2.0 (Applied Biosystems).
    "The -3G/A, -2G/A, and +4C/T DNA variants were genotyped using restriction enzyme analysis. . . The PCR reaction was performed in a total volume of 20 µl containing 100 ng of each primer (EKN1-3F: AGG GCT GGC GCA TGG T and EKN1-3R: GAG ACC GGC AGG CAA GAC), 0.2mM dNTP, 1.5mM magnesium chloride, and 0.5 U Taq polymerase. The PCR reaction consisted of an initial denaturing step at 94°C for 3 min, followed by 35 cycles at 94°C for 30 s, 60°C for 30 s, and 72degC for 30 s, followed by a 10 min extension step at 72degC. PCR products (5 ul) were digested with 5 U of restriction enzyme (New England Biolabs, Beverly, MA, USA) at 37degC for 1.5–2 h. Alleles were identified on 2% agarose gels. Individuals with the GG haplotype for the -3 and -2 DNA changes were identified by the creation of an MspI site. Individuals with the AG haplotype could be distinguished from the AA and GA haplotype by digestion with the restriction enzyme BsmI, which cuts both the GG and the GA haplotypes. The presence of the T at the +4C/T polymorphism would also result in the loss of a BsmI site; therefore, the PCR product was digested with BsmAI to identify individuals with +4T. Neither the -2A nor the +4T alleles were observed in any of the individuals in this sample."

    Analysis Methods: 
    - Categorical analysis: TDT (Transmission Disequilibrium Test) using ETDT program

    - Quantitative analysis: FBAT (Family-Based Association Test), using additive model

    - Linkage disequilibrium estimated using ldmax program

    - P-values adjusted using FDR (false discovery rate) method

    Other Details: 
    Inclusion criteria

    "Information about the symptoms of neurological, medical, and psychiatric disorders was obtained from a structured interview for parents, the Children’s Interview for Psychiatric Syndromes (ChIPS), that screens for 20 psychiatric disorders as well as psychosocial stressors [39], and from a semi-structured interview for teachers [40]. Subjects were excluded if they scored below 80 on both the Performance and Verbal Scales of the Wechsler Intelligence Scale for Children III [41], or showed evidence of neurological or chronic medical illness, bipolar affective disorder, psychotic symptoms, Tourette Syndrome, or chronic multiple tics."

    Diagnostic criteria

    "For the categorical analysis, we designated individuals as having dyslexia if they scored 1.5 standard deviations below the mean (standard score 78 or lower) on two of the three core reading tests (Word Attack, Word Identification, and Wide Range Achievement Test—III Reading subtests) or 1 standard deviation (standard score of 85) on the average of the three."

    Phenotypic measures

    "Reading, spelling, phonological awareness, and rapid naming skills were assessed with the Wide Range Achievement Test-III (WRAT-III) [42], the Word Attack, and Word Identification Subtests of the Woodcock Reading Mastery Test-Revised (WRMTR) [43], and the Comprehensive Test of Phonological Processing (CTOPP) [44]. The Spelling subtest of the WRAT-3 measures the ability to copy marks resembling letters, spell one’s name, and write (ie spell) single words from dictation. The Reading subtest of the WRAT-3 is a standardized measure of single-word reading. The Word Attack subtest of the WRMT-R is a standardized measure comprising a total of 45 printed nonsense words (34 monosyllabic, 11 polysyllabic) to be read aloud, which assess the ability to decode 67 letter-sound categories (vowel patterns, consonant sounds) and syllabification. The Word Identification subtest is a standardized measure comprising 106 real monosyllabic and polysyllabic words of increasing difficulty.
    "Language ability was assessed with the Clinical Evaluation of Language Fundamentals-3rd Edition [45]. The Clinical Evaluation of Language Fundamentals, 3rd Edition (CELF-3), is a widely used standardized measure of receptive and expressive oral language skills, comprising several subtests that assess semantics and syntax. Three receptive subtests (concepts and directions; word classes; and sentence structure (for 7–8-year olds) and semantic relationships (for 9 years and older)) and three Expressive subtests (formulated sentences; recalling sentences, and word structure (7–8-year olds) and sentence assembly (9 and older)) were used.
    "The CTOPP is a comprehensive assessment of phonological awareness, phonological memory, and rapid naming, and has extensive norms. The Rapid Digit Naming subtest measures the speed at which an individual can name the 72 digits displayed on two pages. The Phonological Awareness composite score for 5–6-year olds is composed of the Elision (segmenting spoken words into smaller parts), Blending Words (blending individual presented segments into whole words), and Sound Matching (matching words on the basis of initial and final sounds) subtests. For 7 years and older, the Phonological Awareness composite score is composed of the Elision and Blending Words subtests. Verbal short-term memory was assessed with the CTOPP Nonword Repetition subtest. This test is an 18-item subtest that measures an individual’s ability to repeat a series of nonwords that range in length from 3 to 15 sounds. All these measures have acceptable reliability and validity and good psychometric properties."

    Associated Markers:
    rs11629841  (P = 0.018)  - T and G
    -3GA-1249GT  (P = 0.026)  - G - G
    rs3743204-rs11629841  (P = 0.0089)  - C - G
    rs11629841-rs692691  (P = 0.0058, 0.0389)  - T - T and G - T, respectively


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Susceptibility to developmental dyslexia Brkanac et al 2007 JSON | XML

    Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

    Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

    References (fourth editions of these tests are also now available):

    Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

    Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

    Basic Study Type:  Association study

    Study Cohort: 
    "For the studies reported here, the subject population included 191 families of predominantly Caucasian ethnic background and for the case control study, controls were individuals of Caucasian background in families ascertained for studies on other genetic conditions, without regard for learning disabilities."

    Genotyping Methods: 
    "SNP genotypes were obtained either through direct sequencing of SNP-containing PCR amplicons on an Applied Biosystems (ABI) 3100 automated DNA sequencing capillary electrophoresis instrument and base calling by ABI Sequencing Analysis Software or with TaqMan methodology using an ABI 7500 Real-Time PCR system and ABI Sequence Detection Software. For detection of the deletion in DCDC2, allele-specific amplification of genomic DNA was performed as described by Meng et al. [2005], with the exception that the PCR products were resolved on 2.5% agarose gels. Ability to distinguish the deleted and nondeleted alleles was first validated by sequencing four samples."

    Analysis Methods: 
    TDT (Transmission Disequilibrium Test)

    Other Details: 
    Inclusion criteria

    "Children with neurological or psychiatric disorders or other medical conditions known to be associated with poor reading were excluded, except for attention deficit/hyperactivity disorder."

    Probands were "children in grades 1 through 9 who had demonstrated difficulties learning to read and/or spell. To qualify for participation in the study, the child had to have a prorated verbal IQ (VIQ) >=90 on the Wechsler Intelligence Scale for Children—3rd Edition [Wechsler, 1991], and a score below the population mean and at least 1 SD below their VIQ on at least one of 10 measures of accuracy or speed of single real or non-word reading, accuracy or speed of oral reading of text, spelling or handwriting automaticity.

    Associated Markers:
    1249GT  (P = 0.04)  - G


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Single Letter Backward Span (SLBS) Marino et al 2007 JSON | XML

    Additional Phenotype Details: From the Italian version of the ‘Test of Memory and Learning’ (Reynolds & Bigler 1994). Requires immediate backward recall "of strings of letters that are read aloud by the operator. The strings are increasingly longer at each step. Scores are computed based on the number of correct letters recalled in the correct order for each string."

    Basic Study Type:  Association study

    Study Cohort: 
    Summary: 158 nuclear families with 171 affected children

    "This study is based on a sample of children recruited for reading difficulties from the Department of Child Psychiatry and Rehabilitation Centre at the Eugenio Medea Institute, Bosisio Parini, Italy, a facility where children are referred mainly by paediatricians and teachers from schools of the same geographical area for diagnosis and treatment of a wide range of mental disorders, including learning disorders and dyslexia. . .
    "A total of 158 probands identified as having DD and their biological parents accepted to participate in the study over a period of 37 months. Parents were also asked to allow the participation into the extensive clinical assessment of the probands’ siblings (aged between 6 and 18 years) with a history of reading difficulties/probable dyslexia. Only siblings who met the above-mentioned criteria [see "Other" section] were included in the study. . .The sample consisted in 133 triads, 12 parent-child pairs and 13 nuclear families with two affected offsprings (for a total fo 158 nuclear families with 171 affected children). Probands mean age was 10.9 +/- 2.5 (min 7, max 18) and the male to female sex ratio was 3.5:1. Siblings were included in all analyses."

    Genotyping Methods: 
    "Exons 2 and 10 of the DYX1C1 gene were amplified from genomic DNA of all subjects (primer sequences and amplification protocols are available from the authors on request). We decided that direct sequencing of both exons was the best approach. A 0.5 µl aliquot of each amplified DNA sample was labelled with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Monza, Italy) and sequenced on an ABI3100 Avant Genetic Analyzer (Applied Biosystems). Sequences were aligned with Autoassembler (Applied Biosystems) and scored for known and new polymorphisms."

    Analysis Methods: 
    - TDT (Transmission Disequilibrium Test), using FBAT program version 1.4, using additive model

    - Categorical trait analysis used TRANSMIT version 2.5.4

    - Adjusted P-values using Bonferroni correction

    Other Details: 
    Inclusion/diagnostic criteria

    "Probands were recruited in our sample if they met criteria for DD based on the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM IV) [31]; accordingly, exclusion criteria were the presence of neurological or sensoneural disorders. Reading abilities were investigated through a battery of tests that encompassed several reading tasks standardized on the Italian population [32,33] and the Wechsler Intelligence Scale for Children, Revised [34].
    "Reading tests were as follows:
    "(1) Text Reading: ‘Prove di rapidita` e correttezza nella lettura del gruppo MT’ (‘Test for speed and accuracy in reading, developed by the MT group’), a text-reading task that assesses reading abilities for meaningful material. It provides separate scores for speed (seconds) and accuracy (expressed in number of errors). Texts increase in complexity with grade level. Norms are provided for each text [33].
    "(2) Single word and nonword reading subtests of ‘Batteria per la Valutazione della Dislessia e Disortografia Evolutiva’ (Battery for the assessment of Developmental Reading and Spelling Disorders), Subtests 4 and 5 respectively [32]. These tests assess speed (s) and accuracy (expressed in number of errors) in reading word lists (four lists of 24 words) and nonword lists (three lists of 16 nonwords) and provide grade norms from the second to the last grade of junior high school.
    "Subjects’ scores in each of these tasks are expressed in standard deviation units relative to the norm for the ageappropriate general Italian population. The information gathered in the assessments described above is employed to decide whether each children would meet the following standardized inclusion criteria:
    "(A) Performance on timed text-reading tests at least 2 standard deviations below the general population mean on at least one of the following two parameters: (1) accuracy (2) speed; Or:
    "(B) A text reading score at least 1.5 standard deviations below the general population mean on at least one of the previous parameters, and an absolute score at least 2 standard deviations below the general population mean on accuracy or speed in reading single unrelated words or pronounceable nonwords;
    "And:
    "(C) IQ >=85."


    Phenotypic measures

    "Probands and their siblings were administered a battery of reading relevant tests. Seven different phenotypic measures were then identified:
    "(1) Phonological decoding (PD) defined as the ability to apply the correct grapheme/phoneme correspondence rules to the pronunciation of nonwords. It was measured by the NonWord Reading Subtest (ie Subtest 5) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32]. Both the number of errors (PD accuracy) and the time (PD speed) required to complete the task were recorded.
    "(2) Orthographic coding (OC) defined as the ability to reproduce specific orthographic patterns. It was measured by recording the number of errors (OC accuracy) in writing under dictation Sentences Containing Homophones, Subtest 12 of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32].
    "(3) Word reading (WR), measured by the Single Unrelated Word Reading Subtest (ie Subtest 4) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32]. Both the time (WR speed) required to complete the list and the number of errors (WR accuracy) were recorded.
    "(4) Word spelling (WS), measured by recording the number of errors (WS accuracy) in the Single Unrelated Word Writing Subtest (ie Subtest 10) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32].
    "(5) Nonword spelling (NWS), measured by recording the number of errors (NWS accuracy) in the NonWord Writing Subtest (ie Subtest 11) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32].
    "Raw scores were converted into age-adjusted standard deviation units from the norm by application of the standard norms in the test protocol."

    Associated Markers:
    -3GA  (P = 0.0011)  - A
    -3GA-1249GT  (P = 0.0114)  - A - T


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Short-term memory Dahdouh et al 2009 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "A total of 366 family trios of German descent (300 male and 66 female indices, see Supplementary Table I) were used for this study, which represent a part of a large ongoing national recruitment effort for families with dyslexia."

    Genotyping Methods: 
    SNP genotyping

    "SNP genotyping was carried out using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry (Sequenom). Extension products were analyzed by a Mass ARRAY mass spectrometer (Bruker Daltonik) and peaks were identified using the SpectroTYPER software (Sequenom). All genotypes were scored independently by two individuals blind to the disease status, and tested for Mendelian inheritance using PedCheck. Genotype success ratio (GSR) was >0.80 for all analyzed SNPs. Detailed information on primer sequences, PCR amplification, genotyping procedure and genotype calling can be obtained on request."

    DNA re-sequencing

    "All PCR products were cleaned from unincorporated primers and dNTPs using shrimp alkaline phosphatase and exonuclease I, and further sequenced using a DYEnamic ET Dye terminator kit (Amersham Biosciences). Sequencing products were electrophoresed using a MegaBACE 1000 instrument and MegaBACE long read matrix; visualized using the Sequence Analyzer v3.0 software (Amersham Biosciences) and further aligned using the Pregap and Gap4 software (Staden package; staden.sourceforge.net). In addition, a separate viewer compared each FASTA output from sequencing results to corresponding genomic sequences (NT_010194) using Blast 2 sequences. Detailed information on PCR amplification, sequencing and analysis is available on request."

    Analysis Methods: 
    "Association between dyslexia and SNPs and haplotypes was assessed using the software PDTPHASE [15]. Because there is evidence for a gender-specific genetic influence on dyslexia [16, 17], tests were performed for all families as well as separately for families with a female and a male index patient, respectively. Haplotype analysis was performed using a sliding window approach, with window sizes ranging from two to six. For each sliding window, differences in the haplotype distribution between affected individuals and parents (global p-values) as well as transmission rates of each individual haplotype were analyzed. To assess the significance of our findings the empirical distribution of the test statistics was generated by using 10,000 pedigrees/genotypes simulations under the null hypothesis using SIMPED [18]. To adjust the nominal p-values for the fact of having tested male and female probands separately as well as jointly, a Westfall-Young permutation-based minimum-P step-down procedure was done based on the 10,000 permutations performed [19]. Finally, our testing strategy provided a global empirical association p-value for the whole sample based on 21 x 3 tests (6 single SNPS and 15 haplotype tests on respectively males, females and the joint sample). The analysis of quantitative phenotypes was performed using QPDTPHASE, which is a quantitative trait implementation of the PDT. We used the UNPHASED implementation as for the PDT [15]."

    Other Details: 
    Diagnostic criteria:

    "Briefly, the diagnosis of dyslexia was based on the spelling score using the T distribution of the general population. To be diagnosed as dyslexic, the child had to meet the following discrepancy criterion: based on the correlation between IQ and spelling of 0.4 [12], an anticipated spelling score was calculated. The child was classified as dyslexic if the discrepancy between the anticipated and the observed spelling scores was at least one standard deviation (1 SD)."

    Phenotypic measures:

    "Probands and all siblings fulfilling the inclusion criteria were assessed with several psychometric tests. These tests targeted different aspects of the dyslexia, i.e., word reading, phonological awareness, phonological decoding, rapid naming, STM and orthographic coding (see supplementary information for a more detailed description). Since it has been previously found that association findings might become stronger in samples of severely affected individuals [11], we also stratified our data by the severity of the phenotype (see supplementary information and Schumacher et al. (2006) for the definition of disease severity). As affected probands were defined by discrepancy to the observed spelling score of at least 1 SD, two subgropups of families of more-severely affected children were identified by probands discrepancy of at least 2 and 2.5 SD, respectively."

    Associated Markers:
    rs3743205-rs3743204-rs600753  (P = 0.0046)  - G - G - G Association found in female cohort only


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Verbal short-term memory Bates et al 2010 JSON | XML

    Additional Phenotype Details: May be assessed using the WAIS Digit Span forward.

    Basic Study Type:  Association study

    Study Cohort: 
    "Data were available for 284 dizygotic twin pairs and a further 164 dizygotic families with at least one additional non-twin sibling (203 siblings); and 143 monozygotic twin families; of whom, 74 had an additional sibling and 13 with two siblings. In addition, there were 56 (non-twin) sibling pairings, 9 trios and 1 quadruplet pairing (these included cases of unpaired twins with a sibling), with a further 133 unpaired twins/sibling. Of this sample, 93% had been assessed for the short-term memory phenotype. The sample is 98% Caucasian, predominantly Anglo-Celtic (~82%) and is typical of the Queensland population on a range of traits including intellectual ability. The age range for this sample was 11 and 26 years, with a mean age of 17.5±3; 47.4% of participants were male."

    Genotyping Methods: 
    "Three SNPs typed by Taipale et al. (1259CG, rs61761345/1249GT and rs3743205) and one (rs11629841) by Wigg et al. were selected for typing. An additional 14 tag SNPs were selected by the Tagger program in Haploview (http://www.broadinstitute.org/haploview/). Of these 18, 6 were excluded (including rs11629841) because they failed during the assay design or provided unreliable genotype data. The SNP 1259CG reported by Taipale et al. had a minor allele frequency of only 0.002.
    "Assays were designed using the Sequenom MassARRAY Assay Design (version 3.0) software (Sequenom, San Diego, CA, USA). Forward and reverse PCR primers and a primer extension probes were purchased from Bioneer Corporation (Daejeon, Korea). Genotyping was carried out in standard 384-well plates with 12.5 ng genomic DNA used per sample. We used a modified Sequenom protocol, in which half reaction volumes were used in each of the PCR, Shrimp Alkaline Phosphatase and iPLEX stages giving a total reaction volume of 5.5 ml. The iPLEX reaction products were desalted by diluting samples with 18 ml of water and 3 ml SpectroCLEAN resin (Sequenom) and then were spotted on a SpectroChip (Sequenom), processed and analyzed on a Compact MALDI-TOF Mass Spectrometer by MassARRAY Workstation software (version 3.3) (Sequenom). Allele calls for each 384-well plate were reviewed using the cluster tool in the Spectro-Typer software (Sequenom) to evaluate assay quality. Genotype error checking, including Mendelian inconsistencies, and tests of Hardy–Weinberg equilibrium
    were performed in Pedstats[48] and Sib-pair."

    Analysis Methods: 
    "Single-nucleotide polymorphism and haplotype association analyses were carried out with QTDT and Mendel using a family-based association. Both programs allow monozygotic twins to be included in the analysis, although monozygotic twins’ phenotypic scores are effectively averaged. In line with previous studies, additive models were considered and were evaluated against the null hypothesis of no linkage or association. Univariate analyses of the traits included the covariates of age (and age squared), sex and performance IQ, all of which were significant at P < 0.001. For a SNP explaining 1% of variance in our traits, under an additive model and against a background sibling correlation of 0.30, we have roughly 97% power (a = 0.05) to detect overall association with a SNP with minor allele frequency above 0.05. The potential effects of multiple testing are critical in association studies, and, in addition to closely attending to both the prior expectations and the specific SNPs and effect directions in earlier studies, significance levels were controlled using matSpD to identify independent SNPs and phenotypes."

    Other Details: 
    Phenotypic measures:

    "Regular-word, irregular-word and nonword reading and spelling were assessed using the CORE[42], a reliable 120-word extended version of the Castles and Coltheart test with additional items included to increase the difficulty level for an older sample. This test was administered over the telephone by a trained researcher. From the language test battery, we focus on WAIS Digit span forward, a measure of verbal short-term memory.
    "Test scores on each of the three reading subtests and three spelling tests were calculated as a simple sum of correct items and were Box–Cox45 transformed to normalize their distributions. Intelligence was used as a covariate in all cases, as controlling for general cognitive ability has been shown to increase sensitivity for reading ability. As scores on the verbal IQ are confounded with reading ability, performance IQ was used as a covariate, using performance scales from the Multidimensional Aptitude Battery completed by 1064 subjects as close as possible to their 16th birthday (siblings were a year older on average than twins at the time of testing)."

    Associated Markers:
    rs685935  (P = 0.04)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Non-word reading Bates et al 2010 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "Data were available for 284 dizygotic twin pairs and a further 164 dizygotic families with at least one additional non-twin sibling (203 siblings); and 143 monozygotic twin families; of whom, 74 had an additional sibling and 13 with two siblings. In addition, there were 56 (non-twin) sibling pairings, 9 trios and 1 quadruplet pairing (these included cases of unpaired twins with a sibling), with a further 133 unpaired twins/sibling. Of this sample, 93% had been assessed for the short-term memory phenotype. The sample is 98% Caucasian, predominantly Anglo-Celtic (~82%) and is typical of the Queensland population on a range of traits including intellectual ability. The age range for this sample was 11 and 26 years, with a mean age of 17.5±3; 47.4% of participants were male."

    Genotyping Methods: 
    "Three SNPs typed by Taipale et al. (1259CG, rs61761345/1249GT and rs3743205) and one (rs11629841) by Wigg et al. were selected for typing. An additional 14 tag SNPs were selected by the Tagger program in Haploview (http://www.broadinstitute.org/haploview/). Of these 18, 6 were excluded (including rs11629841) because they failed during the assay design or provided unreliable genotype data. The SNP 1259CG reported by Taipale et al. had a minor allele frequency of only 0.002.
    "Assays were designed using the Sequenom MassARRAY Assay Design (version 3.0) software (Sequenom, San Diego, CA, USA). Forward and reverse PCR primers and a primer extension probes were purchased from Bioneer Corporation (Daejeon, Korea). Genotyping was carried out in standard 384-well plates with 12.5 ng genomic DNA used per sample. We used a modified Sequenom protocol, in which half reaction volumes were used in each of the PCR, Shrimp Alkaline Phosphatase and iPLEX stages giving a total reaction volume of 5.5 ml. The iPLEX reaction products were desalted by diluting samples with 18 ml of water and 3 ml SpectroCLEAN resin (Sequenom) and then were spotted on a SpectroChip (Sequenom), processed and analyzed on a Compact MALDI-TOF Mass Spectrometer by MassARRAY Workstation software (version 3.3) (Sequenom). Allele calls for each 384-well plate were reviewed using the cluster tool in the Spectro-Typer software (Sequenom) to evaluate assay quality. Genotype error checking, including Mendelian inconsistencies, and tests of Hardy–Weinberg equilibrium
    were performed in Pedstats[48] and Sib-pair."

    Analysis Methods: 
    "Single-nucleotide polymorphism and haplotype association analyses were carried out with QTDT and Mendel using a family-based association. Both programs allow monozygotic twins to be included in the analysis, although monozygotic twins’ phenotypic scores are effectively averaged. In line with previous studies, additive models were considered and were evaluated against the null hypothesis of no linkage or association. Univariate analyses of the traits included the covariates of age (and age squared), sex and performance IQ, all of which were significant at P < 0.001. For a SNP explaining 1% of variance in our traits, under an additive model and against a background sibling correlation of 0.30, we have roughly 97% power (a = 0.05) to detect overall association with a SNP with minor allele frequency above 0.05. The potential effects of multiple testing are critical in association studies, and, in addition to closely attending to both the prior expectations and the specific SNPs and effect directions in earlier studies, significance levels were controlled using matSpD to identify independent SNPs and phenotypes."

    Other Details: 
    Phenotypic measures:

    "Regular-word, irregular-word and nonword reading and spelling were assessed using the CORE[42], a reliable 120-word extended version of the Castles and Coltheart test with additional items included to increase the difficulty level for an older sample. This test was administered over the telephone by a trained researcher. From the language test battery, we focus on WAIS Digit span forward, a measure of verbal short-term memory.
    "Test scores on each of the three reading subtests and three spelling tests were calculated as a simple sum of correct items and were Box–Cox45 transformed to normalize their distributions. Intelligence was used as a covariate in all cases, as controlling for general cognitive ability has been shown to increase sensitivity for reading ability. As scores on the verbal IQ are confounded with reading ability, performance IQ was used as a covariate, using performance scales from the Multidimensional Aptitude Battery completed by 1064 subjects as close as possible to their 16th birthday (siblings were a year older on average than twins at the time of testing)."

    Associated Markers:
    rs17819126  (P = 0.0003)
    rs3743204  (P = 0.0089)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Irregular-word spelling Bates et al 2010 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "Data were available for 284 dizygotic twin pairs and a further 164 dizygotic families with at least one additional non-twin sibling (203 siblings); and 143 monozygotic twin families; of whom, 74 had an additional sibling and 13 with two siblings. In addition, there were 56 (non-twin) sibling pairings, 9 trios and 1 quadruplet pairing (these included cases of unpaired twins with a sibling), with a further 133 unpaired twins/sibling. Of this sample, 93% had been assessed for the short-term memory phenotype. The sample is 98% Caucasian, predominantly Anglo-Celtic (~82%) and is typical of the Queensland population on a range of traits including intellectual ability. The age range for this sample was 11 and 26 years, with a mean age of 17.5±3; 47.4% of participants were male."

    Genotyping Methods: 
    "Three SNPs typed by Taipale et al. (1259CG, rs61761345/1249GT and rs3743205) and one (rs11629841) by Wigg et al. were selected for typing. An additional 14 tag SNPs were selected by the Tagger program in Haploview (http://www.broadinstitute.org/haploview/). Of these 18, 6 were excluded (including rs11629841) because they failed during the assay design or provided unreliable genotype data. The SNP 1259CG reported by Taipale et al. had a minor allele frequency of only 0.002.
    "Assays were designed using the Sequenom MassARRAY Assay Design (version 3.0) software (Sequenom, San Diego, CA, USA). Forward and reverse PCR primers and a primer extension probes were purchased from Bioneer Corporation (Daejeon, Korea). Genotyping was carried out in standard 384-well plates with 12.5 ng genomic DNA used per sample. We used a modified Sequenom protocol, in which half reaction volumes were used in each of the PCR, Shrimp Alkaline Phosphatase and iPLEX stages giving a total reaction volume of 5.5 ml. The iPLEX reaction products were desalted by diluting samples with 18 ml of water and 3 ml SpectroCLEAN resin (Sequenom) and then were spotted on a SpectroChip (Sequenom), processed and analyzed on a Compact MALDI-TOF Mass Spectrometer by MassARRAY Workstation software (version 3.3) (Sequenom). Allele calls for each 384-well plate were reviewed using the cluster tool in the Spectro-Typer software (Sequenom) to evaluate assay quality. Genotype error checking, including Mendelian inconsistencies, and tests of Hardy–Weinberg equilibrium
    were performed in Pedstats[48] and Sib-pair."

    Analysis Methods: 
    "Single-nucleotide polymorphism and haplotype association analyses were carried out with QTDT and Mendel using a family-based association. Both programs allow monozygotic twins to be included in the analysis, although monozygotic twins’ phenotypic scores are effectively averaged. In line with previous studies, additive models were considered and were evaluated against the null hypothesis of no linkage or association. Univariate analyses of the traits included the covariates of age (and age squared), sex and performance IQ, all of which were significant at P < 0.001. For a SNP explaining 1% of variance in our traits, under an additive model and against a background sibling correlation of 0.30, we have roughly 97% power (a = 0.05) to detect overall association with a SNP with minor allele frequency above 0.05. The potential effects of multiple testing are critical in association studies, and, in addition to closely attending to both the prior expectations and the specific SNPs and effect directions in earlier studies, significance levels were controlled using matSpD to identify independent SNPs and phenotypes."

    Other Details: 
    Phenotypic measures:

    "Regular-word, irregular-word and nonword reading and spelling were assessed using the CORE[42], a reliable 120-word extended version of the Castles and Coltheart test with additional items included to increase the difficulty level for an older sample. This test was administered over the telephone by a trained researcher. From the language test battery, we focus on WAIS Digit span forward, a measure of verbal short-term memory.
    "Test scores on each of the three reading subtests and three spelling tests were calculated as a simple sum of correct items and were Box–Cox45 transformed to normalize their distributions. Intelligence was used as a covariate in all cases, as controlling for general cognitive ability has been shown to increase sensitivity for reading ability. As scores on the verbal IQ are confounded with reading ability, performance IQ was used as a covariate, using performance scales from the Multidimensional Aptitude Battery completed by 1064 subjects as close as possible to their 16th birthday (siblings were a year older on average than twins at the time of testing)."

    Associated Markers:
    rs17819126  (P = 0.0086)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Irregular-word reading Bates et al 2010 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "Data were available for 284 dizygotic twin pairs and a further 164 dizygotic families with at least one additional non-twin sibling (203 siblings); and 143 monozygotic twin families; of whom, 74 had an additional sibling and 13 with two siblings. In addition, there were 56 (non-twin) sibling pairings, 9 trios and 1 quadruplet pairing (these included cases of unpaired twins with a sibling), with a further 133 unpaired twins/sibling. Of this sample, 93% had been assessed for the short-term memory phenotype. The sample is 98% Caucasian, predominantly Anglo-Celtic (~82%) and is typical of the Queensland population on a range of traits including intellectual ability. The age range for this sample was 11 and 26 years, with a mean age of 17.5±3; 47.4% of participants were male."

    Genotyping Methods: 
    "Three SNPs typed by Taipale et al. (1259CG, rs61761345/1249GT and rs3743205) and one (rs11629841) by Wigg et al. were selected for typing. An additional 14 tag SNPs were selected by the Tagger program in Haploview (http://www.broadinstitute.org/haploview/). Of these 18, 6 were excluded (including rs11629841) because they failed during the assay design or provided unreliable genotype data. The SNP 1259CG reported by Taipale et al. had a minor allele frequency of only 0.002.
    "Assays were designed using the Sequenom MassARRAY Assay Design (version 3.0) software (Sequenom, San Diego, CA, USA). Forward and reverse PCR primers and a primer extension probes were purchased from Bioneer Corporation (Daejeon, Korea). Genotyping was carried out in standard 384-well plates with 12.5 ng genomic DNA used per sample. We used a modified Sequenom protocol, in which half reaction volumes were used in each of the PCR, Shrimp Alkaline Phosphatase and iPLEX stages giving a total reaction volume of 5.5 ml. The iPLEX reaction products were desalted by diluting samples with 18 ml of water and 3 ml SpectroCLEAN resin (Sequenom) and then were spotted on a SpectroChip (Sequenom), processed and analyzed on a Compact MALDI-TOF Mass Spectrometer by MassARRAY Workstation software (version 3.3) (Sequenom). Allele calls for each 384-well plate were reviewed using the cluster tool in the Spectro-Typer software (Sequenom) to evaluate assay quality. Genotype error checking, including Mendelian inconsistencies, and tests of Hardy–Weinberg equilibrium
    were performed in Pedstats[48] and Sib-pair."

    Analysis Methods: 
    "Single-nucleotide polymorphism and haplotype association analyses were carried out with QTDT and Mendel using a family-based association. Both programs allow monozygotic twins to be included in the analysis, although monozygotic twins’ phenotypic scores are effectively averaged. In line with previous studies, additive models were considered and were evaluated against the null hypothesis of no linkage or association. Univariate analyses of the traits included the covariates of age (and age squared), sex and performance IQ, all of which were significant at P < 0.001. For a SNP explaining 1% of variance in our traits, under an additive model and against a background sibling correlation of 0.30, we have roughly 97% power (a = 0.05) to detect overall association with a SNP with minor allele frequency above 0.05. The potential effects of multiple testing are critical in association studies, and, in addition to closely attending to both the prior expectations and the specific SNPs and effect directions in earlier studies, significance levels were controlled using matSpD to identify independent SNPs and phenotypes."

    Other Details: 
    Phenotypic measures:

    "Regular-word, irregular-word and nonword reading and spelling were assessed using the CORE[42], a reliable 120-word extended version of the Castles and Coltheart test with additional items included to increase the difficulty level for an older sample. This test was administered over the telephone by a trained researcher. From the language test battery, we focus on WAIS Digit span forward, a measure of verbal short-term memory.
    "Test scores on each of the three reading subtests and three spelling tests were calculated as a simple sum of correct items and were Box–Cox45 transformed to normalize their distributions. Intelligence was used as a covariate in all cases, as controlling for general cognitive ability has been shown to increase sensitivity for reading ability. As scores on the verbal IQ are confounded with reading ability, performance IQ was used as a covariate, using performance scales from the Multidimensional Aptitude Battery completed by 1064 subjects as close as possible to their 16th birthday (siblings were a year older on average than twins at the time of testing)."

    Associated Markers:
    rs17819126  (P = 0.0199)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Rapid naming Lim et al 2011 JSON | XML

    Additional Phenotype Details: In Lim et al 2011, assessed with a subtest of the Hong Kong Test of Specific Learning Difficulties in Reading and Writing (HKT-SpLD).

    Basic Study Type:  Association study

    Study Cohort: 
    "393 individuals from 131 Chinese families. . .Each family consisted of one dyslexic child, with a total of 95 males and 36 females, aged between 5 and 16 years (mean = 8.68 ± 2.06 years)."

    Genotyping Methods: 
    "Genotyping was performed using Sequenom® MassARRAY® iPLEX Gold assay, according to the manufacturer’s instructions (Sequenom®, San Diego, CA, USA, http://www.sequenom.com). Briefly, 5 ng genomic DNA was first amplified to determine the genomic sequence containing the SNP. The unincorporated dNTPs in the PCR reaction was dephosphorylated by shrimp alkaline phosphatase treatment. This is followed by the iPLEX primer extension reaction to generate allele-specific extension products of different mass. The extension products were cleaned using SpectroClean resin and then dispensed onto SpectroCHIP bioarray. The products were detected using MALDI-TOF mass spectrometry and results were analyzed using SpectroTYPER software."

    Analysis Methods: 
    "Markers were checked for Mendelian inconsistencies and tests of Hardy-Weinberg equilibrium using Pedstats."

    "Family-based and haplotype association analyses were performed using UNPHASED (Version 3.1.2) which employs an allelic likelihood ratio test. Haplotype analysis was performed using 2- or 3- markers sliding windows method. Initially, a global analysis was performed to test for haplotypic association and then the significant haplotypes were subsequently tested for individual haplotype analysis. Haplotypes with frequencies <1% in the whole sample were excluded. The analysis option of conditioning markers was selected for testing direct association of a single marker in the significant haplotypes. Multiple testing was corrected using Qvalue software based on false discovery rates. Permutation test (1000 runs) was also used to run multiple testing corrections over all tests performed in single-marker association analyses of categorical DD. Linkage disequilibrium (LD) was calculated and LD plots were generated using Haploview version 4.1 http://www.broad.mit.edu/mpg/haploview."

    Other Details: 
    Diagnostic criteria:

    "They were diagnosed as DD using the Hong Kong Test of Specific Learning Difficulties in Reading and Writing (HKT-SpLD) and referred by the local education authority, child assessment centres, and a parent association. The HKT-SpLD battery consisted of 12 subtests. The subtest are broken down into three literacy tests, which are Chinese Word Reading, One-minute Reading and Chinese Word Dictation, and one rapid naming test, where subjects were asked to name digits, colours and pictures. Two subtests are phonological awareness which tests the subjects’ awareness of onset and rhymes of Chinese words, and three phonological memory subtests where subjects are asked to repeat orally the syllables presented to them from a tape recorder. The final three subtests are a test of orthographic skills. This consists of 70 simple Chinese integrated characters and Arabic numbers. Half of them were left/right reversed and the subjects were asked to cross out all items with an incorrect orientation.
    "These 12 subtests were combined to yield five composite scores in the domains of literacy, phonological awareness, phonological memory, rapid naming and orthographic skills. The sample characteristics of these phenotypic measures are shown in table 1. To be classified as children with dyslexia, their literacy composite score and at least one cognitive composite score had to be at least one standard deviation (SD = 3) below the means (mean = 10) of their respective ages in the HKT-SpLD (cutoff score = 7). Participants in the dyslexic group fulfilled this diagnostic criterion and all of the subjects showed a normal intelligence on Raven’s Standard Progressive Matrices (with IQs of 85 or above)."

    Associated Markers:
    rs3743205  (P = 0.0079)  - q = 0.0289 FDR-corrected


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia One Minute Reading Lim et al 2011 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "393 individuals from 131 Chinese families. . .Each family consisted of one dyslexic child, with a total of 95 males and 36 females, aged between 5 and 16 years (mean = 8.68 ± 2.06 years)."

    Genotyping Methods: 
    "Genotyping was performed using Sequenom® MassARRAY® iPLEX Gold assay, according to the manufacturer’s instructions (Sequenom®, San Diego, CA, USA, http://www.sequenom.com). Briefly, 5 ng genomic DNA was first amplified to determine the genomic sequence containing the SNP. The unincorporated dNTPs in the PCR reaction was dephosphorylated by shrimp alkaline phosphatase treatment. This is followed by the iPLEX primer extension reaction to generate allele-specific extension products of different mass. The extension products were cleaned using SpectroClean resin and then dispensed onto SpectroCHIP bioarray. The products were detected using MALDI-TOF mass spectrometry and results were analyzed using SpectroTYPER software."

    Analysis Methods: 
    "Markers were checked for Mendelian inconsistencies and tests of Hardy-Weinberg equilibrium using Pedstats."

    "Family-based and haplotype association analyses were performed using UNPHASED (Version 3.1.2) which employs an allelic likelihood ratio test. Haplotype analysis was performed using 2- or 3- markers sliding windows method. Initially, a global analysis was performed to test for haplotypic association and then the significant haplotypes were subsequently tested for individual haplotype analysis. Haplotypes with frequencies <1% in the whole sample were excluded. The analysis option of conditioning markers was selected for testing direct association of a single marker in the significant haplotypes. Multiple testing was corrected using Qvalue software based on false discovery rates. Permutation test (1000 runs) was also used to run multiple testing corrections over all tests performed in single-marker association analyses of categorical DD. Linkage disequilibrium (LD) was calculated and LD plots were generated using Haploview version 4.1 http://www.broad.mit.edu/mpg/haploview."

    Other Details: 
    Diagnostic criteria:

    "They were diagnosed as DD using the Hong Kong Test of Specific Learning Difficulties in Reading and Writing (HKT-SpLD) and referred by the local education authority, child assessment centres, and a parent association. The HKT-SpLD battery consisted of 12 subtests. The subtest are broken down into three literacy tests, which are Chinese Word Reading, One-minute Reading and Chinese Word Dictation, and one rapid naming test, where subjects were asked to name digits, colours and pictures. Two subtests are phonological awareness which tests the subjects’ awareness of onset and rhymes of Chinese words, and three phonological memory subtests where subjects are asked to repeat orally the syllables presented to them from a tape recorder. The final three subtests are a test of orthographic skills. This consists of 70 simple Chinese integrated characters and Arabic numbers. Half of them were left/right reversed and the subjects were asked to cross out all items with an incorrect orientation.
    "These 12 subtests were combined to yield five composite scores in the domains of literacy, phonological awareness, phonological memory, rapid naming and orthographic skills. The sample characteristics of these phenotypic measures are shown in table 1. To be classified as children with dyslexia, their literacy composite score and at least one cognitive composite score had to be at least one standard deviation (SD = 3) below the means (mean = 10) of their respective ages in the HKT-SpLD (cutoff score = 7). Participants in the dyslexic group fulfilled this diagnostic criterion and all of the subjects showed a normal intelligence on Raven’s Standard Progressive Matrices (with IQs of 85 or above)."

    Associated Markers:
    rs3743205  (P = 0.0087)  - q = 0.0289 FDR-corrected


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Susceptibility to developmental dyslexia Lim et al 2011 JSON | XML

    Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

    Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

    References (fourth editions of these tests are also now available):

    Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

    Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

    Basic Study Type:  Association study

    Study Cohort: 
    "393 individuals from 131 Chinese families. . .Each family consisted of one dyslexic child, with a total of 95 males and 36 females, aged between 5 and 16 years (mean = 8.68 ± 2.06 years)."

    Genotyping Methods: 
    "Genotyping was performed using Sequenom® MassARRAY® iPLEX Gold assay, according to the manufacturer’s instructions (Sequenom®, San Diego, CA, USA, http://www.sequenom.com). Briefly, 5 ng genomic DNA was first amplified to determine the genomic sequence containing the SNP. The unincorporated dNTPs in the PCR reaction was dephosphorylated by shrimp alkaline phosphatase treatment. This is followed by the iPLEX primer extension reaction to generate allele-specific extension products of different mass. The extension products were cleaned using SpectroClean resin and then dispensed onto SpectroCHIP bioarray. The products were detected using MALDI-TOF mass spectrometry and results were analyzed using SpectroTYPER software."

    Analysis Methods: 
    "Markers were checked for Mendelian inconsistencies and tests of Hardy-Weinberg equilibrium using Pedstats."

    "Family-based and haplotype association analyses were performed using UNPHASED (Version 3.1.2) which employs an allelic likelihood ratio test. Haplotype analysis was performed using 2- or 3- markers sliding windows method. Initially, a global analysis was performed to test for haplotypic association and then the significant haplotypes were subsequently tested for individual haplotype analysis. Haplotypes with frequencies <1% in the whole sample were excluded. The analysis option of conditioning markers was selected for testing direct association of a single marker in the significant haplotypes. Multiple testing was corrected using Qvalue software based on false discovery rates. Permutation test (1000 runs) was also used to run multiple testing corrections over all tests performed in single-marker association analyses of categorical DD. Linkage disequilibrium (LD) was calculated and LD plots were generated using Haploview version 4.1 http://www.broad.mit.edu/mpg/haploview."

    Other Details: 
    Diagnostic criteria:

    "They were diagnosed as DD using the Hong Kong Test of Specific Learning Difficulties in Reading and Writing (HKT-SpLD) and referred by the local education authority, child assessment centres, and a parent association. The HKT-SpLD battery consisted of 12 subtests. The subtest are broken down into three literacy tests, which are Chinese Word Reading, One-minute Reading and Chinese Word Dictation, and one rapid naming test, where subjects were asked to name digits, colours and pictures. Two subtests are phonological awareness which tests the subjects’ awareness of onset and rhymes of Chinese words, and three phonological memory subtests where subjects are asked to repeat orally the syllables presented to them from a tape recorder. The final three subtests are a test of orthographic skills. This consists of 70 simple Chinese integrated characters and Arabic numbers. Half of them were left/right reversed and the subjects were asked to cross out all items with an incorrect orientation.
    "These 12 subtests were combined to yield five composite scores in the domains of literacy, phonological awareness, phonological memory, rapid naming and orthographic skills. The sample characteristics of these phenotypic measures are shown in table 1. To be classified as children with dyslexia, their literacy composite score and at least one cognitive composite score had to be at least one standard deviation (SD = 3) below the means (mean = 10) of their respective ages in the HKT-SpLD (cutoff score = 7). Participants in the dyslexic group fulfilled this diagnostic criterion and all of the subjects showed a normal intelligence on Raven’s Standard Progressive Matrices (with IQs of 85 or above)."

    Associated Markers:
    rs3743205  (P = 0.0009)  - q = 0.0072 FDR-corrected
    rs804075-rs3743205  (P = 0.0002)  - q = 0.0033 FDR-corrected
    rs3743205-rs4255730  (P = 0.0073)  - q = 0.0255 FDR-corrected
    rs692646-rs692691  (P = 0.0118)  - q = 0.0329 FDR-corrected
    rs8040756-rs3743205-rs4255730  (P = 0.0019)  - q = 0.0131 FDR-corrected


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Identification of left-right reversed characters Lim et al 2011 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "393 individuals from 131 Chinese families. . .Each family consisted of one dyslexic child, with a total of 95 males and 36 females, aged between 5 and 16 years (mean = 8.68 ± 2.06 years)."

    Genotyping Methods: 
    "Genotyping was performed using Sequenom® MassARRAY® iPLEX Gold assay, according to the manufacturer’s instructions (Sequenom®, San Diego, CA, USA, http://www.sequenom.com). Briefly, 5 ng genomic DNA was first amplified to determine the genomic sequence containing the SNP. The unincorporated dNTPs in the PCR reaction was dephosphorylated by shrimp alkaline phosphatase treatment. This is followed by the iPLEX primer extension reaction to generate allele-specific extension products of different mass. The extension products were cleaned using SpectroClean resin and then dispensed onto SpectroCHIP bioarray. The products were detected using MALDI-TOF mass spectrometry and results were analyzed using SpectroTYPER software."

    Analysis Methods: 
    "Markers were checked for Mendelian inconsistencies and tests of Hardy-Weinberg equilibrium using Pedstats."

    "Family-based and haplotype association analyses were performed using UNPHASED (Version 3.1.2) which employs an allelic likelihood ratio test. Haplotype analysis was performed using 2- or 3- markers sliding windows method. Initially, a global analysis was performed to test for haplotypic association and then the significant haplotypes were subsequently tested for individual haplotype analysis. Haplotypes with frequencies <1% in the whole sample were excluded. The analysis option of conditioning markers was selected for testing direct association of a single marker in the significant haplotypes. Multiple testing was corrected using Qvalue software based on false discovery rates. Permutation test (1000 runs) was also used to run multiple testing corrections over all tests performed in single-marker association analyses of categorical DD. Linkage disequilibrium (LD) was calculated and LD plots were generated using Haploview version 4.1 http://www.broad.mit.edu/mpg/haploview."

    Other Details: 
    Diagnostic criteria:

    "They were diagnosed as DD using the Hong Kong Test of Specific Learning Difficulties in Reading and Writing (HKT-SpLD) and referred by the local education authority, child assessment centres, and a parent association. The HKT-SpLD battery consisted of 12 subtests. The subtest are broken down into three literacy tests, which are Chinese Word Reading, One-minute Reading and Chinese Word Dictation, and one rapid naming test, where subjects were asked to name digits, colours and pictures. Two subtests are phonological awareness which tests the subjects’ awareness of onset and rhymes of Chinese words, and three phonological memory subtests where subjects are asked to repeat orally the syllables presented to them from a tape recorder. The final three subtests are a test of orthographic skills. This consists of 70 simple Chinese integrated characters and Arabic numbers. Half of them were left/right reversed and the subjects were asked to cross out all items with an incorrect orientation.
    "These 12 subtests were combined to yield five composite scores in the domains of literacy, phonological awareness, phonological memory, rapid naming and orthographic skills. The sample characteristics of these phenotypic measures are shown in table 1. To be classified as children with dyslexia, their literacy composite score and at least one cognitive composite score had to be at least one standard deviation (SD = 3) below the means (mean = 10) of their respective ages in the HKT-SpLD (cutoff score = 7). Participants in the dyslexic group fulfilled this diagnostic criterion and all of the subjects showed a normal intelligence on Raven’s Standard Progressive Matrices (with IQs of 85 or above)."

    Associated Markers:
    rs3743205  (P = 0.0087)  - q = 0.0289 FDR-corrected


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Nonword repetition Lim et al 2011 JSON | XML

    Additional Phenotype Details: 
    May be assessed using the Nonword Repetition subtest from the Comprehensive Test of Phonological Processing (Wagner et al. 1999).

    Basic Study Type:  Association study

    Study Cohort: 
    "393 individuals from 131 Chinese families. . .Each family consisted of one dyslexic child, with a total of 95 males and 36 females, aged between 5 and 16 years (mean = 8.68 ± 2.06 years)."

    Genotyping Methods: 
    "Genotyping was performed using Sequenom® MassARRAY® iPLEX Gold assay, according to the manufacturer’s instructions (Sequenom®, San Diego, CA, USA, http://www.sequenom.com). Briefly, 5 ng genomic DNA was first amplified to determine the genomic sequence containing the SNP. The unincorporated dNTPs in the PCR reaction was dephosphorylated by shrimp alkaline phosphatase treatment. This is followed by the iPLEX primer extension reaction to generate allele-specific extension products of different mass. The extension products were cleaned using SpectroClean resin and then dispensed onto SpectroCHIP bioarray. The products were detected using MALDI-TOF mass spectrometry and results were analyzed using SpectroTYPER software."

    Analysis Methods: 
    "Markers were checked for Mendelian inconsistencies and tests of Hardy-Weinberg equilibrium using Pedstats."

    "Family-based and haplotype association analyses were performed using UNPHASED (Version 3.1.2) which employs an allelic likelihood ratio test. Haplotype analysis was performed using 2- or 3- markers sliding windows method. Initially, a global analysis was performed to test for haplotypic association and then the significant haplotypes were subsequently tested for individual haplotype analysis. Haplotypes with frequencies <1% in the whole sample were excluded. The analysis option of conditioning markers was selected for testing direct association of a single marker in the significant haplotypes. Multiple testing was corrected using Qvalue software based on false discovery rates. Permutation test (1000 runs) was also used to run multiple testing corrections over all tests performed in single-marker association analyses of categorical DD. Linkage disequilibrium (LD) was calculated and LD plots were generated using Haploview version 4.1 http://www.broad.mit.edu/mpg/haploview."

    Other Details: 
    Diagnostic criteria:

    "They were diagnosed as DD using the Hong Kong Test of Specific Learning Difficulties in Reading and Writing (HKT-SpLD) and referred by the local education authority, child assessment centres, and a parent association. The HKT-SpLD battery consisted of 12 subtests. The subtest are broken down into three literacy tests, which are Chinese Word Reading, One-minute Reading and Chinese Word Dictation, and one rapid naming test, where subjects were asked to name digits, colours and pictures. Two subtests are phonological awareness which tests the subjects’ awareness of onset and rhymes of Chinese words, and three phonological memory subtests where subjects are asked to repeat orally the syllables presented to them from a tape recorder. The final three subtests are a test of orthographic skills. This consists of 70 simple Chinese integrated characters and Arabic numbers. Half of them were left/right reversed and the subjects were asked to cross out all items with an incorrect orientation.
    "These 12 subtests were combined to yield five composite scores in the domains of literacy, phonological awareness, phonological memory, rapid naming and orthographic skills. The sample characteristics of these phenotypic measures are shown in table 1. To be classified as children with dyslexia, their literacy composite score and at least one cognitive composite score had to be at least one standard deviation (SD = 3) below the means (mean = 10) of their respective ages in the HKT-SpLD (cutoff score = 7). Participants in the dyslexic group fulfilled this diagnostic criterion and all of the subjects showed a normal intelligence on Raven’s Standard Progressive Matrices (with IQs of 85 or above)."

    Associated Markers:
    rs3743205  (P = 0.0096)  - q = 0.0289 FDR-corrected


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 SLI Susceptibility to Specific Language Impairment Newbury et al 2011 JSON | XML

    Additional Phenotype Details: 
    Specific Language Impairment may be diagnosed based on an expressive and/or receptive language score less than a certain number of SDs (e.g. 1.5) below the mean for the individual's age on a test such as the Clinical Evaluation of Language Fundamentals (CELF). Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion. See Tomblin et al 1996 for a specific system for diagnosing SLI.


    References

    Semel EM, Wiig EH, Secord W (1992) Clinical evaluation of language fundamentals—revised. Phychological Corporation, San Antonio.

    Tomblin JB, Records NL, Zhang X (1996) A system for the diagnosis of specific language impairment in kindergarten children. J Speech Hear Res 39:1284–1294.

    Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

    Basic Study Type:  Association study

    Study Cohort: 
    Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


    SLI cohort

    "The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

    Dyslexia cohort

    "The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

    For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

    Genotyping Methods: 
    "In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

    Analysis Methods: 
    - QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

    - Also conducted case-control analyses (allelic association test, within PLINK)

    Other Details: 
    SLI cohort, diagnostic criteria:

    "All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

    SLI cohort, other inclusion criteria

    "Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

    SLI cohort, phenotypic measures:

    "Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

    Dyslexia cohort, diagnostic criteria:

    "Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


    Dyslexia cohort, other inclusion criteria
    "Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

    Dyslexia cohort, phenotypic measures

    "We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

    Associated Markers:
    rs57809907  (P = 0.012)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Orthographic coding Newbury et al 2011 JSON | XML

    Additional Phenotype Details: May be assessed by a forced word choice test as in Olson et al 1994, requiring "(identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain" (Newbury et al 2011).

    Basic Study Type:  Association study

    Study Cohort: 
    Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


    SLI cohort

    "The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

    Dyslexia cohort

    "The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

    For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

    Genotyping Methods: 
    "In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

    Analysis Methods: 
    - QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

    - Also conducted case-control analyses (allelic association test, within PLINK)

    Other Details: 
    SLI cohort, diagnostic criteria:

    "All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

    SLI cohort, other inclusion criteria

    "Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

    SLI cohort, phenotypic measures:

    "Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

    Dyslexia cohort, diagnostic criteria:

    "Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


    Dyslexia cohort, other inclusion criteria
    "Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

    Dyslexia cohort, phenotypic measures

    "We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

    Associated Markers:
    rs57809907  (P = 0.0497)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Spelling ability Paracchini et al 2011 JSON | XML

    Additional Phenotype Details: Possible measures include the spelling subtests of any of a number of intelligence and literacy tests, e.g.:

    Peabody Individual Achievement Test (PIAT)
    Western Australian Literacy and Numeracy Assessment (WALNA)
    Wide Range Achievement Test (WRAT)

    Basic Study Type:  Association study

    Study Cohort: 
    "The Raine study is a pregnancy cohort that was recruited prior to 18 weeks’ gestation from the public antenatal clinic at King Edward Memorial Hospital (KEMH) or surrounding private clinics in Perth, Western Australia (WA) (Newnham et al . 1993). Approximately 100 unselected antenatal patients per month were enrolled during this period from August 1989 to April 1992, with a final sample of 2979 women. . .From this original cohort of women, 2868 of their children have been followed over the last two decades with detailed assessments performed every 2–3 years."

    Genotyping Methods: 
    "In the Raine study, DNA was collected using standardized procedures from 74% of adolescence who attended the 14-year follow-up on and a further 5% at the 16-year follow-up. Genome-wide data were generated using an Illumina 660 Quad array for each individual. Only SNPs that passed quality control (QC) criteria (call rate >= 95%, minor allele frequency >0.05 and Hardy–Weinberg disequilibrium P-value >0.01) were retained for genetic analysis."

    Analysis Methods: 
    "Our first analysis examined selected SNPs within the DYX1C1, KIAA0319, DCDC2 and MRPL19/C2ORF3 genes that have been previously found to be associated with dyslexia. Fourteen of these SNPs were available for the Raine sample (Table S2). These SNPs were tested for association with quantitative measures of reading and spelling scores (Table 1) using an allelic test of also tested for association haplotypes derived from the markers at theMRPL19/C2ORF3 locus, as previously reported (Anthoni et al. 2007). Haplotypes were inferred using SIMHAP version 1.0.2. In all analyses, gender was specified as a covariate. Principal components analysis with Eigenstrat (Price et al . 2006) showed evidence of population stratification and the first two principal components were also included in all analyses.
    ". . .The LD among DYX1C1 SNPs in this sample was determined with HAPLOVIEW version 4.2 (http://www.broadinstitute.org/haploview/haploview) (Barrett et al. 2005). Power calculations were computed using QUANTO version 4.02 (Gauderman et al. 2002) (Fig. S1)."

    Other Details: 
    Raine study inclusion criteria

    "The inclusion criteria were (1) English language skills sufficient to understand the study demands, (2) an expectation to deliver at KEMH and (3) an intention to remain in WA to enable future follow-up of their child."

    Sample inclusion criteria

    "Inclusion criteria for the current study were no known intellectual disability; a nonverbal IQ within normal limits as assessed by the Raven’s Colored Progressive Matrices (CPM; i.e. a score >=16th percentile, corresponding to approximately >-1 SD the population average of the 50th centile) and biological parents who were both of white European origin. Furthermore, because the current study had an interest in literacy development of the birth cohort, only those children who spoke English at home were included for analysis."

    Reading and spelling assessment of children at age 10 years

    "The Western Australian Literacy and Numeracy Assessment (WALNA) is administered annually to all students across WA in school grades three (age 8), five (age 10) and seven (age 12). The WALNA on whether children have reached theminimum standards of reading, writing, spelling and numeracy. The tests have been written to cater for the diverse range of students in Australian schools, and to ensure that there is no systematic bias associated with factors such as gender, culture or geographic location. Every year the WALNA is evaluated by expert judges for content and construct validity and scrutinized by psychometricians for misfitting items, precision and bias. The current study concerned performance on the reading and spelling subtests of the WALNA, completed by the Raine cohort during school grade 5 (between 2000 and 2002).
    "For the reading test, children were given a magazine and required to answer 33 multiple-choice questions on its contents. A further two questions required a short answer of one to two sentences each. For each item, children were directed to the relevant page and article title (e.g. ‘read Helicopter on page 2 of the magazine and answer questions 1–5’). The spelling subtest consisted of two tasks. In the first task, participants were provided with a written paragraph that included 10 spelling mistakes, each of which were circled. The passage was first read aloud by the teacher from beginning to end. The teacher then read through the passage again, this time pausing at each circled word (spelling mistake), upon which children were required to write down the correct spelling of the word. The second spelling task was similar to the first; however, rather than spelling mistakes, the written passage given to children included 14 blank spaces for missing words. The passage, including the missing words, was then read aloud by the teacher twice: the first time, children were instructed to follow the text with their finger, and the second time, children were required to write down each missing word. For items in both the spelling and reading tests, a score (of 1) was awarded for correct answers only. Raw scores for the reading and spelling tests were summed and then converted via a Rasch measurement model (Doig & Groves 2006) into an interval scale to enable easier interpretation of the results. Scores on both the reading and spelling subscales could range from -100 to 800, with higher scores indicating better performance.
    "These data, collected by the WA Department of Education and Training, were then linked to the Raine study dataset by the WA Data Linkage System using a probabilistic method of matching based on a full name, date of birth, gender and address (Kelman et al . 2002). Western Australian Literacy and Numeracy Assessment records were linked for 1038 Raine study children who were in grade five and attending government schools at the time of assessment."

    Associated Markers:
    rs7174102  (P = 0.036)
    rs8037376  (P = 0.027)
    rs8043049  (P = 0.012)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Text reading Paracchini et al 2011 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "The Raine study is a pregnancy cohort that was recruited prior to 18 weeks’ gestation from the public antenatal clinic at King Edward Memorial Hospital (KEMH) or surrounding private clinics in Perth, Western Australia (WA) (Newnham et al . 1993). Approximately 100 unselected antenatal patients per month were enrolled during this period from August 1989 to April 1992, with a final sample of 2979 women. . .From this original cohort of women, 2868 of their children have been followed over the last two decades with detailed assessments performed every 2–3 years."

    Genotyping Methods: 
    "In the Raine study, DNA was collected using standardized procedures from 74% of adolescence who attended the 14-year follow-up on and a further 5% at the 16-year follow-up. Genome-wide data were generated using an Illumina 660 Quad array for each individual. Only SNPs that passed quality control (QC) criteria (call rate >= 95%, minor allele frequency >0.05 and Hardy–Weinberg disequilibrium P-value >0.01) were retained for genetic analysis."

    Analysis Methods: 
    "Our first analysis examined selected SNPs within the DYX1C1, KIAA0319, DCDC2 and MRPL19/C2ORF3 genes that have been previously found to be associated with dyslexia. Fourteen of these SNPs were available for the Raine sample (Table S2). These SNPs were tested for association with quantitative measures of reading and spelling scores (Table 1) using an allelic test of also tested for association haplotypes derived from the markers at theMRPL19/C2ORF3 locus, as previously reported (Anthoni et al. 2007). Haplotypes were inferred using SIMHAP version 1.0.2. In all analyses, gender was specified as a covariate. Principal components analysis with Eigenstrat (Price et al . 2006) showed evidence of population stratification and the first two principal components were also included in all analyses.
    ". . .The LD among DYX1C1 SNPs in this sample was determined with HAPLOVIEW version 4.2 (http://www.broadinstitute.org/haploview/haploview) (Barrett et al. 2005). Power calculations were computed using QUANTO version 4.02 (Gauderman et al. 2002) (Fig. S1)."

    Other Details: 
    Raine study inclusion criteria

    "The inclusion criteria were (1) English language skills sufficient to understand the study demands, (2) an expectation to deliver at KEMH and (3) an intention to remain in WA to enable future follow-up of their child."

    Sample inclusion criteria

    "Inclusion criteria for the current study were no known intellectual disability; a nonverbal IQ within normal limits as assessed by the Raven’s Colored Progressive Matrices (CPM; i.e. a score >=16th percentile, corresponding to approximately >-1 SD the population average of the 50th centile) and biological parents who were both of white European origin. Furthermore, because the current study had an interest in literacy development of the birth cohort, only those children who spoke English at home were included for analysis."

    Reading and spelling assessment of children at age 10 years

    "The Western Australian Literacy and Numeracy Assessment (WALNA) is administered annually to all students across WA in school grades three (age 8), five (age 10) and seven (age 12). The WALNA on whether children have reached theminimum standards of reading, writing, spelling and numeracy. The tests have been written to cater for the diverse range of students in Australian schools, and to ensure that there is no systematic bias associated with factors such as gender, culture or geographic location. Every year the WALNA is evaluated by expert judges for content and construct validity and scrutinized by psychometricians for misfitting items, precision and bias. The current study concerned performance on the reading and spelling subtests of the WALNA, completed by the Raine cohort during school grade 5 (between 2000 and 2002).
    "For the reading test, children were given a magazine and required to answer 33 multiple-choice questions on its contents. A further two questions required a short answer of one to two sentences each. For each item, children were directed to the relevant page and article title (e.g. ‘read Helicopter on page 2 of the magazine and answer questions 1–5’). The spelling subtest consisted of two tasks. In the first task, participants were provided with a written paragraph that included 10 spelling mistakes, each of which were circled. The passage was first read aloud by the teacher from beginning to end. The teacher then read through the passage again, this time pausing at each circled word (spelling mistake), upon which children were required to write down the correct spelling of the word. The second spelling task was similar to the first; however, rather than spelling mistakes, the written passage given to children included 14 blank spaces for missing words. The passage, including the missing words, was then read aloud by the teacher twice: the first time, children were instructed to follow the text with their finger, and the second time, children were required to write down each missing word. For items in both the spelling and reading tests, a score (of 1) was awarded for correct answers only. Raw scores for the reading and spelling tests were summed and then converted via a Rasch measurement model (Doig & Groves 2006) into an interval scale to enable easier interpretation of the results. Scores on both the reading and spelling subscales could range from -100 to 800, with higher scores indicating better performance.
    "These data, collected by the WA Department of Education and Training, were then linked to the Raine study dataset by the WA Data Linkage System using a probabilistic method of matching based on a full name, date of birth, gender and address (Kelman et al . 2002). Western Australian Literacy and Numeracy Assessment records were linked for 1038 Raine study children who were in grade five and attending government schools at the time of assessment."

    Associated Markers:
    rs8040756  (P = 0.026)


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Orthographic judgment Zhang et al 2012 JSON | XML

    Basic Study Type:  Association study

    Study Cohort: 
    "We used data from a general population cohort of 284 unrelated children who were recruited from maternal-child health care clinics to develop the Chinese Communicative Development Inventory (CCDI) in 2000 [35] and were demographically representative of the city of Beijing."

    Genotyping Methods: 
    "The three SNPs (rs3743205, rs11629841, and rs57809907) that showed significant associations in previous studies [15,17] were genotyped using the MassArray system (Sequenom) with primers and probes shown in Table S3. The sample success rates for all three SNPs reached 100%. Four samples were genotyped twice and the reproducibility of the genotyping was 100%."

    Analysis Methods: 
    - HWE (Hardy-Weinberg Equilibrium) test and association test performed within PLINK

    - Linkage disequilibrium of SNPs estimated with Haploview Version 4.2

    - P-values adjusted using Bonferroni correction

    Other Details: 
    Inclusion criteria

    "All of these children were tested annually on a variety of tasks as part of a large longitudinal study and all met the following inclusion criteria: native Mandarin speakers, no known intellectual disability, and a nonverbal IQ within normal limits as assessed by the Raven’s Standard Progressive Matrices [36] (i.e., a score >=16th percentile, corresponding to approximately >= -1 SD from the population average of the 50th percentile)."

    Phenotypic measures

    "The selection of tasks for the present study was based on the criterion that each had been administered for at least three years (except for the visual-spatial relationship subtest) and appeared to make use of some visual or orthographic skills. These included tests of single Chinese character reading and dictation, visual-related skills, and orthographic awareness."

    Associated Markers:
    rs11629841  (P = 0.0003, 0.0198)  - For children aged 7 and 8, respectively


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Chinese character dictation Zhang et al 2012 JSON | XML

    Additional Phenotype Details: 

    In Zhang et al 2012, "Children were required to write down target characters that were orally presented. Characters were all familiar and presented within the context of two- to four-character words. All target characters were listed in order of increasing difficulty. The final score of this dictation test was the total number of characters correctly written down."

    Reference
    Zhang et al (2012) Association of the DYX1C1 dyslexia susceptibility gene with orthography in the Chinese population. Plos One 7, e42969.

    Basic Study Type:  Association study

    Study Cohort: 
    "We used data from a general population cohort of 284 unrelated children who were recruited from maternal-child health care clinics to develop the Chinese Communicative Development Inventory (CCDI) in 2000 [35] and were demographically representative of the city of Beijing."

    Genotyping Methods: 
    "The three SNPs (rs3743205, rs11629841, and rs57809907) that showed significant associations in previous studies [15,17] were genotyped using the MassArray system (Sequenom) with primers and probes shown in Table S3. The sample success rates for all three SNPs reached 100%. Four samples were genotyped twice and the reproducibility of the genotyping was 100%."

    Analysis Methods: 
    - HWE (Hardy-Weinberg Equilibrium) test and association test performed within PLINK

    - Linkage disequilibrium of SNPs estimated with Haploview Version 4.2

    - P-values adjusted using Bonferroni correction

    Other Details: 
    Inclusion criteria

    "All of these children were tested annually on a variety of tasks as part of a large longitudinal study and all met the following inclusion criteria: native Mandarin speakers, no known intellectual disability, and a nonverbal IQ within normal limits as assessed by the Raven’s Standard Progressive Matrices [36] (i.e., a score >=16th percentile, corresponding to approximately >= -1 SD from the population average of the 50th percentile)."

    Phenotypic measures

    "The selection of tasks for the present study was based on the criterion that each had been administered for at least three years (except for the visual-spatial relationship subtest) and appeared to make use of some visual or orthographic skills. These included tests of single Chinese character reading and dictation, visual-related skills, and orthographic awareness."

    Associated Markers:
    rs11629841  (P = 0.012, 0.009, 0.013)  - For children aged 9, 10, and 11, respectively.


    Comments


    Post a new comment

    Sign In or Register to post a comment.

    161582 DYX1C1 15q21.3 Dyslexia Reading and memory composite scores Mascheretti et al 2013 JSON | XML

    Additional Phenotype Details: "Reading was assessed by the text reading test (Cornoldi & Colpo 1995, 1998) and the single unrelated word and non-word reading subtests (Sartori et al . 1995), whereby both the number of errors (accuracy) and the time required to complete tasks (speed) were measured."

    "Memory was assessed by single letter/number forward/backward spans from the Italian version of the Test of Memory and Learning (TOMAL) (Reynolds & Bigler 1994). These tasks require immediate forward/backward recall of increasingly longer strings of letters/numbers that are read aloud by the operator; scores are computed based on the number of correct letters/numbers recalled in the correct position for each string."

    Composite for each created by averaging measures within each task.

    Basic Study Type:  Association study (including gene-by-environment effects)

    Study Cohort: 
    "Currently, the sample consists of 451 nuclear families with DNA available, 342 of whom with complete neuropsychological information. For the present sib-pair study, only the 228 families with >1 children and complete neuropsychological information were asked to participate, and 168 (73.7%) families provided acceptance to participate."

    Genotyping Methods: 
    "We chose to genotype some of the most replicated markers spanning within the four DD candidate genes. Regarding DYX1C1, we selected three of the most replicated markers (i.e. -3G/A, 1249 G/T and 1259C/G) both in clinical (Lim et al . 2011; Scerri & Schulte-K¨orne 2010) and in general population samples (Bates et al. 2010; Paracchini et al. 2011). In relation to the 6p21 area, the contribution of two among the most replicated markers within the DCDC2 gene, that is rs793862A/G and BV677278 (Marino et al . 2012; Scerri & Schulte-K¨orne 2010), and of four among the most reproduced markers within both the KIAA0319 and the TTRAP genes (i.e. rs2038137G/T, rs4504469C/T, rs9461045C/T and rs2143340A/G; Scerri & Schulte-K¨orne 2010) were investigated. Markers rs2835676G/T, rs2038136G/C and rs2038135G/T were typed as a by-product of rs2038137G/T sequencing. There is one published association study of the ROBO1 gene (Bates et al. 2011), and we selected the two markers that showed the strongest association with reading-related phenotypes (i.e. rs6803202C/T and rs4535189G/A).
    "Sample collection, DNA extraction and exons 2 and 10 of the DYX1C1 gene were amplified from genomic DNA (primer sequences and amplification protocols are available from the authors on request). A 0.5 µl aliquot of each amplified DNA sample was labeled with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Monza, Italy) and sequenced on an ABI3100 Avant Genetic Analyzer (Applied Biosystems). Sequences were aligned with Autoassembler (Applied Biosystems) and scored for known and new polymorphisms. Subjects were scored for polymorphisms at -3G/A, 1249 G/T and 1259C/G. The genotyping of the intron 2 deletion of the DCDC2 gene was genotyped by allelic-specific amplification with a combination of three primers in one reaction. Markers DCDC2 rs793862A/G, KIAA0319 rs2835676G/T, KIAA0319 rs2038137G/T, KIAA0319 rs2038136G/C and KIAA0319 rs2038135G/T were typed by polymerase chain reaction amplification followed by sequencing (primer sequences are available on request). Markers ROBO1 rs6803202C/T, ROBO1 rs4535189G/A, KIAA0391 rs4504469C/T, TTRAP rs2143340A/G and KIAA0319 rs9461045C/T were typed using TaqMan SNP Genotyping assays (Life Technologies) on a 7900HT Sequence Detection System (Applied Biosystems). After screening for marker–marker linkage disequilibrium, we identified redundant markers (data available upon request). Genotyped markers showing D values >=0.95 were then dropped. On this basis, a minimal set of 10 markers was then chosen for further analyses: markers DYX1C1 ?3G/A, 1249 G/T and 1259C/G; the DCDC2/intron 2 deletion and marker DCDC2 rs793862A/G; markers KIAA0319 rs4504469C/T, rs2038137G/T, rs9461045C/T; marker TTRAP rs2143340A/G; ROBO1 marker rs6803202C/T."

    Analysis Methods: 
    "General test of GxE interaction in sib-pair-based association analysis of quantitative traits (van der Sluis et al . 2008; Appendix S1). Briefly, this is an extension of the Fulker et al . (1999) maximum likelihood variance components analysis of quantitative traits in sib-pairs data that incorporates environmental main effects plus GxE effects (van der Sluis et al . 2008)." Permutation tests and FDR adjustment (Storey 2002) were used.

    There were "21 tests performed for each marker (7 environmental variables × 3 phenotypes), separately for each marker. Gender was taken into account in the extended equation because probands’ sex ratio (males : females) in our sample was nearly 3:1, and it may imply differences in mean scores between males and females."

    Other Details: 
    Diagnostic criteria:

    "After parental informed written consent, families of Italian origins were recruited if probands met the criteria for DD according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) (American Psychiatric Association 1994), confirmed by an extensive clinical investigation, a battery of reading tests standardized on the Italian population (Cornoldi & Colpo 1995, 1998; Sartori et al . 1995), and the Wechsler Intelligence Scale for Children, Revised (WISC-R) (Wechsler 1981) or the Wechsler Intelligence Scale for Children, third edition (WISC-III) (Wechsler 2006). The criteria used to define the probands’ affection status were (1) either accuracy or speed 2.0 SD at or below expected grade level on any text, word or non-word reading tests (2) total IQ above 85 and (3) absence of neurological or sensorial disorders. Sibs of affected probands were administered two subtests of the WISC-R, or of the WISC-III, i.e. vocabulary and block design, that show a high correlation (r ) with, respectively, Verbal IQ (r =0.82; Wechsler 1981, 2006) and Performance IQ (r =0.73; Wechsler 1981, 2006). If the mean score of vocabulary and block design subtests was above 7 (i.e. -1 SD) – regardless of reading performance – sibs were included in the study."

    Phenotypic measures:
    "A thorough neuropsychological assessment was administered to probands and siblings and scores were standardized against a normative control dataset (Cornoldi & Colpo 1995, 1998; Reynolds & Bigler 1994; Sartori et al . 1995). . .
    "Reading was assessed by the text reading test (Cornoldi & Colpo 1995, 1998) and the single unrelated word and non-word reading subtests (Sartori et al . 1995), whereby both the number of errors (accuracy) and the time required to complete tasks (speed) were measured. Spelling was assessed by the number of errors in the untimed single unrelated word, non-word and sentences containing homophones writing under dictation subtests (Sartori et al . 1995). Memory was assessed by single letter/number forward/backward spans from the Italian version of the Test of Memory and
    Learning (TOMAL) (Reynolds & Bigler 1994). These tasks require immediate forward/backward recall of increasingly longer strings of letters/numbers that are read aloud by the operator; scores are computed based on the number of correct letters/numbers recalled in the correct position for each string. Three composites were created by averaging each task within reading (both accuracy and speed measures), spelling and memory, as mean bivariate correlations (r ) were substantial within each domains (reading r =0.486, spelling r =0.563 and memory r =0.422)."

    Associated Markers:
    1259C/G 


    Comments


    Post a new comment

    Sign In or Register to post a comment.


    Negative evidence for association with DYX1C1

    Conflicting Ref Year Original Report Failed Association Comment
    Bellini et al 2005 Taipale et al (2003) Susceptibility to developmental dyslexia (Dyslexia) No significant evidence for association between dyslexia and -3G/A and 1249G/T variants in DYX1C1 in Italian population

    Basic Study Type: 

    Study Cohort: 
    "Fifty-seven unrelated dyslexic patients (37 boys, 20 girls; mean age 12 +/- 5 yr) were recruited from the Departments of Pediatrics and Child Neuropsychiatry of Naples, Catania, and Messina (Southern Italy)."

    Genotyping Methods: 
    "Polymorphism detection was performed by PCR, using primers kindly provided by J. Kere (Taipale et al., 2003) and enzymatic restriction, according to Taipale et al. (2003). As –3G/A is located in the same restriction site of another SNP reported previously, –2G/A, carriers of the A allele after restriction were sequenced using the Big Dye Terminator reaction kit and ABI Prism 310 (Applera)."

    Analysis Methods: 
    Chi-square test for association

    Other Details: 
    Inclusion/diagnostic criteria

    "The inclusion criteria, leading to diagnosis of developmental dyslexia, were based on DMS-IV guidelines, showing reading performance 2 S.D. below the mean for the same age and/or school degree. In the absence of neurological, ophthalmological, and audiophonological deficits, an IQ >= 85
    was also requested.
    "The battery of tests included the revised Wechsler Intelligence Scale for Children; the standard reading text, Prove Mental Tests (MT) Velocità e Correttezza, Prove MT Comprensione (test for speed and accuracy in reading, developed by the MT group); and single-word/nonword reading, Lettura di Parole e non Parole della Batteria Sartori (battery for the assessment of developmental reading and spelling disorders) (Wechsler, 1981; Cornoldi et al., 1986)."

    Meng et al 2005 Taipale et al (2003) Susceptibility to developmental dyslexia (Dyslexia) This study failed to find association between the two most significant EKN1 / DYX1C1 polymorphisms and dyslexia in a cohort of 522 subjects from 150 North American nuclear families

    Basic Study Type: 

    Study Cohort: 
    "The Colorado twin dyslexia cohort was ascertained through the Colorado Learning Disabilities Research Center (CLDRC) (DeFries et al. 1987). Predominantly white middle-class families were ascertained from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. . .Genotyping for the variants reported in the study by Taipale et al. (2003) was performed on a subset of these twin families, consisting of 522 subjects (parents and siblings) from 150 nuclear families. Genotype data was available from both parents for 100 families. The only selection criterion for this subset was that DNA had been isolated from blood rather than buccal samples. The average age of the 221 offspring was 11.55 years, ranging from 8.02 to 18.53 years."

    Genotyping Methods: 
    "Genotyping was performed with TaqMan Assay-by-Design (Applied Biosystems, Foster City, CA) and with pyrosequencing (Biotage AB, Uppsala, Sweden). Assay-by-Design probes were used to genotype the 1249G -> T polymorphism. Polymerase chain reactions (PCR) were performed in a 384-well format in a total reaction volume of 2 ul with 1.6 ng of template DNA. PCR conditions were: denaturation for 10 min at 95°C, followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. Fluorescent signals were converted to genotypes by the sequence detection system software package (SDS, Applied Biosystems, Foster City, CA).
    "The -3G -> A (rs3743205) and the consecutive -2G -> A polymorphisms were genotyped via pyrosequencing using two PCR amplification primers (forward PCR primer: ATTAACCCTCACTAAAGGGACAAGCAGGCGCAAGAAGCAACCAG, reverse PCR primer: TTCTAATACGACTCACTATAGGGAGACACGCCTTTGAGGGGCAGAGACAG) and an extension primer (CTAACCTGAAGAGGCATT). A 20 µl PCR reaction contained 10 ng of genomic DNA, 0.4 units of Hotstart Taq polymerase (Qiagen), 4 pmoles of forward PCR primer, 0.4 pmol of reverse PCR primer, and 3.6 pmol of biotinylated T3 primer, 2.5 mM MgCl2, and 200 µM of dNTPs. Thermal cycling conditions were 15 min at 95°C, followed by 45 cycles (30 s at 95°C, 45 s at 56°C, 60 s at 72°C), 5 min at 72°C, and a hold at 4°C. Upon completion of PCR, the biotinylated PCR product from the entire reaction was purified by binding to streptavidin–sepharose (Amersham) using the filter prep tool according to the standard protocol provided by Biotage. The resulting single stranded template was annealed with the extension primer for 2 min at 80°C, cooled to room temperature and sequenced in a PSQ96MA Pyrosequencing instrument. The PSQ96MA software (version 2.0.2) automatically scored the quality of each reaction and assigned genotypes."

    Analysis Methods: 
    - QTDT (Quantitative Traits Disequilibrium Test) using additive model, with permutation tests

    - SimWalk2 version 2.6.0 to estimate identity-by-descent probabilities

    Other Details: 
    Inclusion criteria

    "Subjects for whom English was a second language were not included in the sample. Subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were also excluded."

    Phenotypic measures

    "Subjects were brought to the CLDRC for an extensive battery of psychometric tests, which consisted of many cognitive, language, and reading tasks, including the intelligence quotient (Wechsler 1974, 1981) and the peabody individual achievement test (PIAT) (Dunn and Markwardt 1970). Quantitative-trait data were provided for the following nine individual phenotypes and three composites: orthographic coding, orthographic choice, homonym choice, phonological decoding, phonemic awareness, phoneme transposition, phoneme deletion, timed word recognition, standardized PIAT word recognition, orthographic coding composite, phonemic awareness composite, and discriminant score. These psychometric tasks have been described in detail elsewhere (DeFries and Fulker 1985; DeFries et al. 1997; Gaya´n et al. 1999; Olson et al. 1989). The population average was estimated from the large twin database available at the CLDRC. After age regression and standardization, the phenotypic data for each of the reading tasks formed a continuous distribution of quantitative z scores, which were used in the analyses."

    Scerri et al 2004 Taipale et al (2003) Susceptibility to developmental dyslexia (Dyslexia) This study failed to find association between EKN1 / DYX1C1 polymorphisms and dyslexia in a cohort of 1153 individuals in 264 nuclear families in the UK.

    Basic Study Type: 

    Study Cohort: 
    Summary: 264 familes (1153 individuals), each including at least one severely dyslexic child

    "The sample of 264 nuclear families analysed in this study consists of 173 families described in previous reports [10] and an additional set of 91 families similarly ascertained through the dyslexia clinic at the Royal Berkshire Hospital, Reading. The complete sample now contains 1153 individuals, including 630 siblings measured for a series of reading and language related quantitative traits. More than 68% of these families had, in addition to a proband with severe dyslexia, at least one other child with some evidence of reading related problems (for example, based on school history or parental report) [11, 12]. The remaining families (less than 32%) contained at least one severely dyslexic proband without a requirement for reading impairment in an additional sibling, and comprised the majority of the last 91 families ascertained."

    Genotyping Methods: 
    "SNPs were genotyped for all individuals (parents and children) using the MassEXTEND assay from Sequenom, according to the manufacture’s instructions. This technique is based on the analysis of allele specific primer extension products using matrix assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. All individuals were also genotyped for highly polymorphic microsatellite markers by semi-automated fluorescent genotyping techniques, and quality checked as previously described [10,11]. All primer sequences are available on request."

    Analysis Methods: 
    - PEDSTATS used to test for Hardy-Weinberg equilibrium

    - MERLIN to check for genotyping errors and construct most likely haplotypes

    - QTDT (Quantitative Traits Disequilibrium Test)

    - GENEHUNTER (2.1_r2 beta) for multi-point linkage analysis

    Other Details: 
    Phenotypic measures

    "A battery of psychometric tests was administered to each proband, as described in earlier publications [11, 12]. These included standard tests of single word reading (READ) and spelling (SPELL), accompanied by tests aimed at measuring a variety of reading and language related cognitive abilities. Phoneme awareness (PA), defined as the ability to reflect on and manipulate the separate speech units that make up a word, was assessed via performance on a ‘‘spoonerism’’ task. Phonological decoding (PD), the ability to convert a sequence of written symbols into their corresponding phonemes, was measured with a non-word reading test. Orthographic coding (OC), the ability to recognise orthographic representations of whole words and retrieve appropriate phonological representations from a mental lexicon, was assessed with two complementary tests, a forced choice task (OC-choice) and a test involving reading of irregular words (OC-irreg). We have shown previously [12] that these quantitative traits are significantly familial in our UK sample. More details of phenotype measurements, including standardisation methods and descriptive statistics, have been extensively described elsewhere [12, 13]."

    Marino et al 2005 Taipale et al (2003) Susceptibility to developmental dyslexia (Dyslexia) This study failed to find association between EKN1 / DYX1C1 polymorphisms and dyslexia or reading-related phonological phenotypes in a sample of 158 families with at least one child with dyslexia

    Basic Study Type: 

    Study Cohort: 
    Summary: 158 nuclear families with 171 affected children

    "This study is based on a sample of children recruited for reading difficulties from the Department of Child Psychiatry and Rehabilitation Centre at the Eugenio Medea Institute, Bosisio Parini, Italy, a facility where children are referred mainly by paediatricians and teachers from schools of the same geographical area for diagnosis and treatment of a wide range of mental disorders, including learning disorders and dyslexia. . .
    "A total of 158 probands identified as having DD and their biological parents accepted to participate in the study over a period of 37 months. Parents were also asked to allow the participation into the extensive clinical assessment of the probands’ siblings (aged between 6 and 18 years) with a history of reading difficulties/probable dyslexia. Only siblings who met the above-mentioned criteria [see "Other" section] were included in the study. . .The sample consisted in 133 triads, 12 parent-child pairs and 13 nuclear families with two affected offsprings (for a total fo 158 nuclear families with 171 affected children). Probands mean age was 10.9 +/- 2.5 (min 7, max 18) and the male to female sex ratio was 3.5:1. Siblings were included in all analyses."

    Genotyping Methods: 
    "Exons 2 and 10 of the DYX1C1 gene were amplified from genomic DNA of all subjects (primer sequences and amplification protocols are available from the authors on request). We decided that direct sequencing of both exons was the best approach. A 0.5 µl aliquot of each amplified DNA sample was labelled with a BigDye Terminator cycle sequencing kit (Applied Biosystems, Monza, Italy) and sequenced on an ABI3100 Avant Genetic Analyzer (Applied Biosystems). Sequences were aligned with Autoassembler (Applied Biosystems) and scored for known and new polymorphisms."

    Analysis Methods: 
    - TDT (Transmission Disequilibrium Test), using FBAT program version 1.4, using additive model

    - Categorical trait analysis used TRANSMIT version 2.5.4

    - Adjusted P-values using Bonferroni correction

    Other Details: 
    Inclusion/diagnostic criteria

    "Probands were recruited in our sample if they met criteria for DD based on the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM IV) [31]; accordingly, exclusion criteria were the presence of neurological or sensoneural disorders. Reading abilities were investigated through a battery of tests that encompassed several reading tasks standardized on the Italian population [32,33] and the Wechsler Intelligence Scale for Children, Revised [34].
    "Reading tests were as follows:
    "(1) Text Reading: ‘Prove di rapidita` e correttezza nella lettura del gruppo MT’ (‘Test for speed and accuracy in reading, developed by the MT group’), a text-reading task that assesses reading abilities for meaningful material. It provides separate scores for speed (seconds) and accuracy (expressed in number of errors). Texts increase in complexity with grade level. Norms are provided for each text [33].
    "(2) Single word and nonword reading subtests of ‘Batteria per la Valutazione della Dislessia e Disortografia Evolutiva’ (Battery for the assessment of Developmental Reading and Spelling Disorders), Subtests 4 and 5 respectively [32]. These tests assess speed (s) and accuracy (expressed in number of errors) in reading word lists (four lists of 24 words) and nonword lists (three lists of 16 nonwords) and provide grade norms from the second to the last grade of junior high school.
    "Subjects’ scores in each of these tasks are expressed in standard deviation units relative to the norm for the ageappropriate general Italian population. The information gathered in the assessments described above is employed to decide whether each children would meet the following standardized inclusion criteria:
    "(A) Performance on timed text-reading tests at least 2 standard deviations below the general population mean on at least one of the following two parameters: (1) accuracy (2) speed; Or:
    "(B) A text reading score at least 1.5 standard deviations below the general population mean on at least one of the previous parameters, and an absolute score at least 2 standard deviations below the general population mean on accuracy or speed in reading single unrelated words or pronounceable nonwords;
    "And:
    "(C) IQ >=85."


    Phenotypic measures

    "Probands and their siblings were administered a battery of reading relevant tests. Seven different phenotypic measures were then identified:
    "(1) Phonological decoding (PD) defined as the ability to apply the correct grapheme/phoneme correspondence rules to the pronunciation of nonwords. It was measured by the NonWord Reading Subtest (ie Subtest 5) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32]. Both the number of errors (PD accuracy) and the time (PD speed) required to complete the task were recorded.
    "(2) Orthographic coding (OC) defined as the ability to reproduce specific orthographic patterns. It was measured by recording the number of errors (OC accuracy) in writing under dictation Sentences Containing Homophones, Subtest 12 of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32].
    "(3) Word reading (WR), measured by the Single Unrelated Word Reading Subtest (ie Subtest 4) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32]. Both the time (WR speed) required to complete the list and the number of errors (WR accuracy) were recorded.
    "(4) Word spelling (WS), measured by recording the number of errors (WS accuracy) in the Single Unrelated Word Writing Subtest (ie Subtest 10) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32].
    "(5) Nonword spelling (NWS), measured by recording the number of errors (NWS accuracy) in the NonWord Writing Subtest (ie Subtest 11) of the Battery for the Assessment of Developmental Reading and Spelling Disorders [32].
    "Raw scores were converted into age-adjusted standard deviation units from the norm by application of the standard norms in the test protocol."

    Venkatesh et al 2011 Taipale et al (2003) Susceptibility to developmental dyslexia (Dyslexia) Failed to find significant association between six SNPs in DYX1C1 (including rs57809907) and dyslexia in a population of 50 cases of children with dyslexia and 50 controls in an Indian population

    Basic Study Type: 

    Study Cohort: 
    "Fifty children with DD aged 6–18 years were recruited. All these children were diagnosed and certified by All India Institute of Speech and Hearing, Mysore and National Institute of Mental Health and Neuroscience, Bangalore, Karnataka state, India. . .A sample of fifty group-age-matched children without DD constituted a comparison group. The male and female ratio in the present study was 59:41 (M:F)."

    Genotyping Methods: 
    "DNA was extracted from 5 ml venous EDTA blood by using the Promega Wizard genomic DNA purification kit, and the quality of the DNA was checked by spectrophotometer. Genotyping was carried out for 20 previously reported SNPs of DYX1C1, KIAA0319 and DCDC2 (Table 1) by MassARRAY using Sequenome-iPLEXR Gold SNP genotyping platform with Spectro-CHIPR and MALDITOF Mass spectrometer (Wilke et al. 2009)."

    Analysis Methods: 
    Chi-square test for association

    Other Details: 
    Diagnostic criteria

    "The diagnosis was established by interviewing parents and teachers, examining the students’ notebooks, as well as by administration of general intellectual ability and reading and dictation school tests common in India."

    Zou et al 2012 Taipale et al (2003) Susceptibility to developmental dyslexia (Dyslexia) This meta-analysis pooled 734 cases, 1067 controls, and 586 families with genotyping of the -3G>A polymorphism in DYX1C1 identified by Taipale et al. (2003). This polymorphism did not show a significant influence on dyslexia susceptibility.

    Basic Study Type: 

    Study Cohort: 
    "734 cases, 1067 controls and 586 families concerning the -3G>A in DYX1C1 and 869 cases, 999 controls and 347 families concerning the 931C>T in KIAA0319 to examine the associations between these two variants and dyslexia risk."

    Analysis Methods: 
    "Data from each case–control and TDT studies were extracted to summarize two-by-two tables and two-by-one tables, respectively. According to the method described by Kazeem and Farrall [2005] ORs, 95%CIs and standard errors (SEs)were calculated for individual study on the basis of allele data. The between-study heterogeneity was assessed by X2-based Cochran’s Q-statistic test and the heterogeneity was considered present when P<0.10. Data from studies were pooled by a fixed-effects model when heterogeneity was negligible; otherwise, the random-effects model was applied. For the synthesis of case–control and TDT studies, Kazeem and Farrall [2005] outlined a methodological improvement for achieving integration by a fixed-effects approach, and then Nicodemus subsequently extended this method to the random-effects model [Nicodemus, 2008]. After obtaining the estimate of logarithm of the OR and its associated SE in each case–control or TDT study, the estimate of pooled OR and its associated SE can be calculated by a weighted analysis method [Hedges and Olkin, 1985]. The Catmap software for this method can be downloaded from the comprehensive R network http://www.r-project.org [Nicodemus, 2008]. Stratified analyses were conducted, if feasible, according to ethnicity, study design, sample size and publication year. Publication bias was assessed by Egger’s test [Egger et al., 1997]. In addition, sensitivity analysis was performed to evaluate the influence of each study on the overall estimate. All statistical analyses were carried out in Catmap software V1.6, and all P values are two-tailed with a significant level at 0.05."

    Other Details: 
    "Identification and Eligibility of Relevant Studies

    "We conducted an electronic search for relevant literatures published before March 29, 2012 from MEDLINE, EMBASE, and ISI Web of Science with the combinations of the following terms ‘‘DYX1C1, or EKN1, or KIAA0319,’’ ‘‘polymorphism or variant’’ and ‘‘dyslexia or reading disability.’’ To expand the coverage of our searches, we further performed searches in Chinese Biomedical (CBM) database with the translation of all English searching items. Referencesof the retrieved articles and reviews were also checked for additional studies.
    "We included all the case–control and TDT studies with human subjects that investigated the association between DYX1C1 or KIAA0319 polymorphism and dyslexia risk with genotyping data for at least one of the two polymorphisms, 3G>A in DYX1C1 and 931C>T in KIAA0319 in all languages. Animal studies, reviews, simply commentaries, case reports, unpublished reports and studies not offering necessary data to calculate odds ratios (ORs) and 95% confidence intervals (CIs) were excluded. Studies with overlapping data were carefully considered and the report with complete design or larger sample size was finally selected. Additionally, if studies applied case–control and TDT designs in the same or overlapping probands, the design with larger sample size was ultimately included."

    Saviour et al 2008 Taipale et al (2003) Susceptibility to developmental dyslexia (Dyslexia) Failed to find association between -3G>A and 1249G>T SNPS (as well as two other SNPs) and developmental dyslexia in an Indian population of 52 children with dyslexia and 51 controls.