SLDB

Speech/Language Disorders Database

Hello Guest! Login | Register

Gene / phenotype associations for GPLD1

  • Click column headers to sort. Click to expand any row to see more details about the particular assertion of an association between variants of GPLD1 and a particular phenotypic variable.
  • Click the Pubmed IDs in the last column to link out to the primary research article. Click the links in the last column to download the full Genotype-Phenotype record as JSON or XML formatted text.
Entrez Id Symbol Location Disorder Brief Phenotype Reference Year Download
2822 GPLD1 6p22.1 Phoneme awareness Meng et al 2005 JSON | XML

Additional Phenotype Details: 

May be measured by any of several tasks, such as phoneme reversal or phoneme deletion. For example, Newbury et al 2011 used the Spoonerisms Test from the Phonological Assessment battery (PhAB), while Parracchini et al 2008 used a phoneme deletion test from the Auditory Analysis Task.

References

Gallagher A, Frederickson N (1995) The phonological assessment battery (PhAB): an initial assessment of its theoretical and practical utility. Educ Child Psychol 12:53–67

Newbury DF, Paracchini S, Scerri TS, Winchester L, Addis L, Richardson AJ, Walter J, Stein JF, Talcott JB, Monaco AP (2011) Investigation of dyslexia and SLI risk variants in reading- and language-impaired subjects. Behavior Genetics 41, 90-104.

Paracchini S, Steer CD, Buckingham LL, Morris AP, Ring S, Scerri T, Stein J, Pembrey ME, Ragoussis J, Golding J, Monaco AP (2008) Association of the KIAA0319 dyslexia susceptibility gene with reading skills in the general population. The American Journal Of Psychiatry 165, 1576-84.

Rosner J, Simon DP: The Auditory Analysis Test: an initial report. J Learning Disabilities 1971; 4:40–48

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_2100460  (P = 0.0295)
C_7454980  (P = 0.0103)
C_2100479  (P = 0.0382)


Comments


Post a new comment

Sign In or Register to post a comment.

2822 GPLD1 6p22.1 Homonym choice Meng et al 2005 JSON | XML

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_7454980  (P = 0.0171)
C_2100443  (P = 0.0018)
C_2100442  (P = 0.016)
C_9359852  (P = 0.0293)


Comments


Post a new comment

Sign In or Register to post a comment.

2822 GPLD1 6p22.1 Orthographic choice Meng et al 2005 JSON | XML

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_7454980  (P = 0.031)


Comments


Post a new comment

Sign In or Register to post a comment.

2822 GPLD1 6p22.1 Word recognition in timed task Meng et al 2005 JSON | XML

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_7454980  (P = 0.0328)


Comments


Post a new comment

Sign In or Register to post a comment.

2822 GPLD1 6p22.1 Phoneme transposition Meng et al 2005 JSON | XML

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_2100460  (P = 0.025)
C_7454980  (P = 0.0139)
C_2100479  (P = 0.0456)


Comments


Post a new comment

Sign In or Register to post a comment.