SLDB

Speech/Language Disorders Database

Hello Guest! Login | Register

Gene / phenotype associations for KIAA0319

  • Click column headers to sort. Click to expand any row to see more details about the particular assertion of an association between variants of KIAA0319 and a particular phenotypic variable.
  • Click the Pubmed IDs in the last column to link out to the primary research article. Click the links in the last column to download the full Genotype-Phenotype record as JSON or XML formatted text.
Entrez Id Symbol Location Disorder Brief Phenotype Reference Year Download
9856 KIAA0319 6p22.3-6p22.2 Dyslexia Discriminant score for reading Deffenbacher et al 2004 JSON | XML

Additional Phenotype Details: Weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT (Peabody individual achievement test), used in: Meng et al 2005, DCDC2 is associated with reading disability and modulates neuronal development in the brain. Proceedings Of The National Academy Of Sciences Of The United States Of America 102, 17053-8.

Basic Study Type: Linkage and association studies

Study Cohort: - DZ and MZ twin pairs (where at least one twin had a history of reading problems) and their families
- 1,559 individuals (349 nuclear families)
- Recruited from Colorado school districts

- Linkage study used all subjects
- Association study used 114 families (those with at least one child with a phenotypic score <=2 SD below mean)

Genotyping Methods: Linkage study

"Twenty-two dinucleotide repeat markers were selected for genotyping spanning 22 Mb (22 cM) on chromosome 6p21.3 (Table 1). DNA was extracted from blood or buccal samples collected from
parents and offspring. Genotyping was carried out with multiplexed fluorescently labeled primers on an ABI 3700 DNA Analyzer (Applied Biosystems). Allele calls were made by using Genotyper software version 3.7 (Applied Biosystems), and inheritance checking was performed with Genetic Analysis System (GAS) software, version 2.0 (A. Young, Oxford University, 1993–1995). The error
function in Merlin (Abecasis et al. 2002) was used to flag potential genotyping errors for re-analysis."

Association study

"SNPs were selected from the ABI Assays-on-Demand website, which offers optimized TaqMan assays for validated SNPs. SNPs were chosen based on heterozygosity, marker spacing, and a preferential location within candidate genes. Table 2 lists the 31 SNPs that were genotyped. The selected SNPs span ten genes that cluster within ~680 kb of our linkage interval, giving an average marker density of ~21 kb. SNPs were genotyped by TaqMan assay with Fam and Vic labeled MGB probes. Polymerase chain reactions were set up according to the manufacturer’s protocol and thermocycled in T-Gradient thermo-cyclers (Biometra). Endpoint fluorescent readings and allele calling were carried out on an ABI 7000 sequence detection system (SDS) with 7000SDS software (Applied Biosystems). Inheritance and error checking of allele calls were carried out as above with GAS and Merlin, respectively."

Analysis Methods: Linkage study

- Multipoint identity-by-descent values computed using GeneHunter
- Single-point linkage analysis using SIBPAL, implemented in S.A.G.E.
- Analysis performed on all 708 sib-pairs, and on samples with severe scores (at least one sib with one score 20th percentile or lower)
- S.A.G.E. implements revised Haseman-Elston analysis (using both squared trait difference and mean-corrected trait sum)
- Multipoint analysis used non-parametric lod score in GeneHunter, DeFries-Fulker basic method in QMS2, revised H-E method in QMS2
- Significance critierion for linkage: P<=0.05 and z>=1.5

Association study

- FBAT (family-based association test) with dominant and additive models
- QTDT (Quantitative Traits Disequilibrium Test) using orthogonal (Abecasis et al 2000), Allison (1997), and Rabinowitz (1997) models
- Orthogonal and Allison tests used variance components framework modeling environmental, additive, and polygenic effects
- QTDT significance levels based on 1,000 Monte Carlo permutations
- Intermarker LD using LD (GOLD) (Abecasis and Cookson 2000)
- Founder haplotypes and recombinations using Simwalk2
- Haplotypes analyzed using GeneHunter TDT option with 4-marker sliding window
- TDT significance calculated with 1,000 permutations with perm1 option in GeneHunter
- Four-marker haplotypes showing association analyzed using FBAT on markers in isolation

Other Details: Exclusion criteria:

"Subjects with sensory deficits, neurological, or emotional problems were excluded from the sample."

Phenotypes (all quantitative)

- DISC score assessing overall reading ability.
- Component phenotypes (tests described in Gayán et al. 1999):
Phoneme awareness
Phonological decoding
Single-word reading
Orthographic coice


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Susceptibility to developmental dyslexia Cope et al 2005 JSON | XML

Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

References (fourth editions of these tests are also now available):

Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

Associated Markers:
rs6935076  (P = 0.006)
rs4504469  (P = 0.002)
rs2179515  (P = 0.007)
rs2038137  (P = 0.001)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Orthographic coding Meng et al 2005 JSON | XML

Additional Phenotype Details: Assessed using a forced word choice test

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_3073667  (P = 0.011)
C_7466818  (P = 0.0282)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Homonym choice Meng et al 2005 JSON | XML

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_3073667  (P = 0.0107)
C_7466818  (P = 0.0456)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Orthographic choice Meng et al 2005 JSON | XML

Basic Study Type:  - Association study - Brain expression analysis - RNAi (in utero RNA interference) in rats

Study Cohort: 
"The 536 samples (parents and siblings) consisted of 153 nuclear families collected by the CLDRC (17). . . Further descriptions of subjects and RD phenotypes are found in Supporting Methods and Materials, which is published as supporting information on the PNAS web site."

From the Supporting Methods and Materials:

"Subjects included members of monozygotic (MZ) twin pairs (in which case, only one member of the MZ twin pair was used), dizygotic (DZ) twin pairs, and nontwin siblings. There were 34 families with one offspring, 94 families with two offspring, 19 families with three offspring, and 6 families with four or five offspring. Predominantly white middle-class families were recruited from school districts in the state of Colorado, where at least one sibling had a school history of reading problems. . .The average age of the 221 siblings analyzed was 11.55 years, ranging from 8.02 to 18.53 years."


RNA samples:

"Total RNA samples from 18 areas of adult human brain were purchased from Ambion (see Fig. 4) and were procured from 10 white donors ranging in age from 45 to 79 years, with unknown handedness. RNA samples could not be localized to either the left or right hemispheres. Six donors were male. Seven donors died because of cardiac (e.g., congestive heart failure) or respiratory disease (e.g., respiratory failure), one had liver cancer, one had bladder cancer, and one was listed as unknown."

Genotyping Methods: 
"TaqMan Assay-on-Demand and Assay-by-Design probes (Applied Biosystems, Foster City, CA) were used to genotype 109 and 39 SNPs, respectively. Six SNPs failed web-based primer design for TaqMan and, consequently, were genotyped by pyrosequencing (Biotage, Uppsala). The primers for these SNPs are presented in Table 2, which is published as supporting information on the PNAS web site."

"Deletion genotype. The common 2,445-bp deletion was genotyped by allele-specific amplification with a combination of three primers in one reaction: universal forward primer (AGCCTGCCTACCACAGAGAA), reverse primer for nondeleted chromosomes (GGAACAACCTCACAGAAATGG), and reverse primer for deleted chromosomes (TGAAACCCCGTCTCTACTGAA). Reaction products were resolved on 1.5% agarose gels. The deletion fusion fragment was 225 bp, and the nondeleted fragment was 550bp."

"dbSTS ID no. 808238 genotype. The compound STR, dbSTS ID no. 808238, was genotyped by sequencingPCRproducts generatedwith a forward primer (TGTTGAATCCCAGACCACAA) and reverse primer (ATCCCGATGAAATGAAAAGG). The sequencing method is described below. Sequence traces results were analyzed and alleles assigned with MUTATION SURVEYOR version 2.6 (SoftGenetics) by comparing samples to reference traces after alignment."

Analysis Methods: 
"We used QTDT to simultaneously test for transmission disequilibrium in the presence of linkage by the orthogonal model (-ao) with variance components (-wega), and permutations for exact P values (-m1000 -1). Through different modeling within QTDT, we tested for parent of origin effects (-ot), the significance of polygenic effects (-weg), evidence for linkage without association (-vega), total association (-at), and population stratification (-ap). HAPLOVIEW and GOLD were used to examine the haplotype structure of the markers, to generate haplotype blocks, and to assess intermarker linkage disequilibrium. Haplotype-TDT was analyzed by FBAT."

Other Details: 
Inclusion criteria

"Subjects with an intelligence quotient (IQ) < 80 or for whom English was a second language were not included in the initial samplem " and "subjects with evidence of serious neurological, emotional, or uncorrected sensory deficits were excluded from the present analyses."


All subjects (not the brain donors) underwent testing for 11 phenotypes (listed below), and the resulting distribution of z-scores was used in the analysis.

Phenotypes tested for (from Supporting Information):

"Orthographic coding (OC) is the ability to recognize words’ specific orthographic patterns and was measured here with our experimental tests for orthographic choice (OCH) and homonym choice (HCH), a composite score for both tests (i.e., OC composite) was created by averaging the z scores for both tasks. Phonological decoding (PD) is the oral reading of nonwords, which have straightforward pronunciations that are based on their spelling. Phonemic awareness (PA) is the ability to isolate and manipulate abstract subsyllabic sounds in speech; for the present analyses, it was measured with our experimental phoneme-transposition (PTP) and phoneme-deletion (PDL) tasks, and with a composite score for both tests. Word recognition (WR) is a composite of our experimental timed-word-recognition (TWR) task and the untimed standardized PIAT word-recognition (PWR) task, which requires subjects to read words aloud. Finally, the discriminant score (DISC) for reading was a weighted composite of the reading recognition, reading comprehension, and spelling subtests of the PIAT [Peabody individual achievement test]."



Quantitative Real-Time RT-PCR:

"TaqMan gene expression kits for eight genes in the candidate region (KIAA0319, DCDC2, MRS2L, GPLD1, ALDH5A1, TTRAP, THEM2, andGMNN) and six control genes (GAPDH, 18S, beta-actin, HPRT1, PPIA, and PKG1) were purchased from Applied Biosystems. Details are described in Supporting Methods and Materials."

In Utero RNA Interference (RNAi):

"Plasmids were directly introduced into cells at the cerebral ventricular zone of living rat embryos by in utero electroporation as described in ref. 24. Cells were cotransfected with pCA-eGFP and DCDC2 small hairpin RNA (shRNA) plasmid or control shRNA plasmid. The shRNA plasmid directed against DCDC2 contained the hairpin sequence 5'-cccaccaagcaattccagacaa(aca)ttgtctggaattgcttggtggg-3' and the control sequence was 5'-cccagtcaaggcattgaattaaa(aca)tttaattcaatgccttgactggg-3'. The sequence was selected by its asymmetry and for the absence of any matches to rat genomic sequence in the database. Four days after transfection, rat embryonic brains were fixed with 4% paraformaldehyde and sectioned with a vibratome (Leica VT1000S) at 60~80 um. Nuclei were labeled with TOP-PRO-3 (Molecular Probes). Images were acquired with a Leica TCS SP2 confocal microscope system (0.5~1.0 um optical section) and processed by using PHOTOSHOP 7.0 (Adobe Systems). For cumulative probability migration plots, the distance of each cell (200–1,400 cells in each analysis condition) from the VZ surface was determined 4 days after transfection. Migration distances were determined with automated particle analyses in IMAGEJ (National Institutes of Health, Bethesda)."

Associated Markers:
C_3073667  (P = 0.023)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Susceptibility to developmental dyslexia Harold et al 2006 JSON | XML

Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

References (fourth editions of these tests are also now available):

Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

Associated Markers:
rs761100  (P = 0.00004)  - Combined P-value across Oxford and Cardiff samples
rs4504469  (P = 0.00024)  - Combined P-value across Oxford and Cardiff samples
rs2179515  (P = 0.00011)  - Combined P-value across Oxford and Cardiff samples
rs2038137  (P = 0.00002)  - Combined P-value across Oxford and Cardiff samples
rs1555090  (P = 0.00015)  - Combined P-value across Oxford and Cardiff samples


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Principal component reading and spelling CORE score Luciano et al 2007 JSON | XML

Additional Phenotype Details: Principal component obtained from Components of Reading Examination (CORE)

Associated Markers:
rs6935076  (P = 0.01)
rs4504469-rs2038137-rs2143340 211 haplotype  (P = 0.02)
rs4504469-rs2038137-rs2143340 111 haplotype  (P = 0.02)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Bivariate Word Reading Luciano et al 2007 JSON | XML

Additional Phenotype Details: Cambridge and Schonell Whole-Word Reading Tests

Associated Markers:
rs4504469-rs2038137-rs2143340 112 haplotype  (P = 0.04)
rs4504469-rs2038137-rs2143340 211 haplotype  (P = 0.02)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Single-word reading Ludwig et al 2008 JSON | XML

Additional Phenotype Details: Possible measures include the single-word reading subtest of Wechsler Objective Reading Dimensions
(WORD), and the British Ability Scales (BAS) test of single-word reading.


References

Elliot CD, Murray DJ, Pearson LS (1979) The British ability scales. NFER, Slough, UK

Rust J, Golombok S, Trickey G (1993) Wechsler objective reading dimensions. Psychological Corporation, Sidcup.

Associated Markers:
rs761100  (P = 0.0351)  - P-value for interaction with rs793862-rs807701 (A-C) DCDC2 risk haplotype (effect on word reading)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Phoneme awareness Paracchini et al 2008 JSON | XML

Additional Phenotype Details: 

May be measured by any of several tasks, such as phoneme reversal or phoneme deletion. For example, Newbury et al 2011 used the Spoonerisms Test from the Phonological Assessment battery (PhAB), while Parracchini et al 2008 used a phoneme deletion test from the Auditory Analysis Task.

References

Gallagher A, Frederickson N (1995) The phonological assessment battery (PhAB): an initial assessment of its theoretical and practical utility. Educ Child Psychol 12:53–67

Newbury DF, Paracchini S, Scerri TS, Winchester L, Addis L, Richardson AJ, Walter J, Stein JF, Talcott JB, Monaco AP (2011) Investigation of dyslexia and SLI risk variants in reading- and language-impaired subjects. Behavior Genetics 41, 90-104.

Paracchini S, Steer CD, Buckingham LL, Morris AP, Ring S, Scerri T, Stein J, Pembrey ME, Ragoussis J, Golding J, Monaco AP (2008) Association of the KIAA0319 dyslexia susceptibility gene with reading skills in the general population. The American Journal Of Psychiatry 165, 1576-84.

Rosner J, Simon DP: The Auditory Analysis Test: an initial report. J Learning Disabilities 1971; 4:40–48

Associated Markers:
rs4504469-rs6935076 2-1 haplotype  (P = 0.03)  - Age 7


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Spelling ability Paracchini et al 2008 JSON | XML

Additional Phenotype Details: Performance in spelling 15 words of increasing difficulty

Associated Markers:
rs2143340  (P = 0.03)  - Age 7


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Reading Paracchini et al 2008 JSON | XML

Additional Phenotype Details: Wechsler Objective Reading Dimensions test (Rust et al., 1993)

Associated Markers:
rs2143340  (P = 0.003)  - Age 7
rs4504469-rs6935076 2-1 haplotype  (P = 0.008)  - Age 7


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Spelling ability Dennis et al 2009 JSON | XML

Additional Phenotype Details: Possible measures include the spelling subtests of any of a number of intelligence and literacy tests, e.g.:

Peabody Individual Achievement Test (PIAT)
Western Australian Literacy and Numeracy Assessment (WALNA)
Wide Range Achievement Test (WRAT)

Associated Markers:
rs3212236  (P = 0.0209; 0.0024)  - P-values for entire UK sample and severe UK subset, respectively
rs9461045  (P = 0.0104; 0.0018)  - P-values for entire UK sample and severe UK subset, respectively
rs9467247  (P = 0.0084; 0.0020)  - P-values for entire UK sample and severe UK subset, respectively


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Orthographic coding in forced word choice Dennis et al 2009 JSON | XML

Additional Phenotype Details: assessed using a forced word choice test

Associated Markers:
rs3212236  (P = 0.018; 0.0013)  - P-values for entire UK sample and severe UK subset, respectively
rs9461045  (P = 0.0097; 0.0003)  - P-values for entire UK sample and severe UK subset, respectively
rs9467247  (P = 0.0044; 0.0001)  - P-values for entire UK sample and severe UK subset, respectively


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Orthographic coding of irregular words Dennis et al 2009 JSON | XML

Additional Phenotype Details: use of word-specific spelling patterns to recognize irregular words

Associated Markers:
rs3212236  (P = 0.0175; 0.0013)  - P-values for association with entire UK sample and severe subset, respectively
rs9461045  (P = 0.0046; 0.0006)  - P-values for association with entire UK sample and severe subset, respectively
rs9467247  (P = 0.0025; 0.0003)  - P-values for association with entire UK sample and severe subset, respectively


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Reduced expression of KIAA0319 Dennis et al 2009 JSON | XML

Associated Markers:
rs9461045   - Significant reduction of luciferase expression with introduction of rs9461045 risk allele in neuronal and non-neuronal cell lines


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Phonological decoding ability Dennis et al 2009 JSON | XML

Additional Phenotype Details: use of rule-like letter-sound relations to derive the pronunciation of pseudowords

Associated Markers:
rs9461045  (P = 0.0489)  - P-value for severe UK subset only (no significant association with full sample)
rs9467247  (P = 0.0362)  - P-value for severe UK subset only (no significant association with full sample)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Single-word reading Dennis et al 2009 JSON | XML

Additional Phenotype Details: Possible measures include the single-word reading subtest of Wechsler Objective Reading Dimensions
(WORD), and the British Ability Scales (BAS) test of single-word reading.


References

Elliot CD, Murray DJ, Pearson LS (1979) The British ability scales. NFER, Slough, UK

Rust J, Golombok S, Trickey G (1993) Wechsler objective reading dimensions. Psychological Corporation, Sidcup.

Associated Markers:
rs3212236  (P = 0.0008)  - P-values for entire UK sample and severe UK subset, respectively
rs9461045  (P = 0.0003)  - P-value for severe UK subset only (no association for full sample)
rs9467247  (P = 0.0002)  - P-values for entire UK sample and severe UK subset, respectively


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI General language skills Rice et al 2009 JSON | XML

Additional Phenotype Details: 

The following are examples of standardized tests for various aspects of language ability:

Clinical Evaluation of Language Fundamentals (CELF)
Test of Language Development (TOLD)
Test of Early Grammatical Impairment (TEGI)
Comprehensive Test of Phonological Processing subtest (CTOPP)
Peabody Picture Vocabulary Test (PPVT)

Additional measures include utterance length and performance on a non-word repetition task (NWR).

Basic Study Type:  Linkage and association studies

Study Cohort: 
Summary:

322 subjects (86 probands, 134 siblings, 102 parents and other relatives)

Detail:

Participants "were drawn from an ongoing longitudinal study of Specific Language Impairment. . .There were 86 probands, mean ages 6;1 to 8;10 across variables, ascertained from school speech pathology caseloads followed by assessment to meet the requirements of the study. There were a total of 134 siblings: 77 males, mean age 8;6; 57 females, mean age 8;5. Previous studies report longitudinal outcomes for part of this sample, documenting that the children’s language impairments persist into adolescence [13, 69–72]."

Genotyping Methods: 
For linkage study:

"Several extended families were included, and some phenotypes were available for relatives besides siblings. The pair counts for each phenotype by the type of relative are shown in Table 3, and these data were included in the linkage analyses. . .Well-characterized microsatellite markers in the critical regions of linkage were identified through the NCBI UNISTS website, with intermarker centimorgan distances taken from the Rutgers Combined Linkage-Physical map v2 [89]. Markers were selected to be about 2 cM apart, particularly targeting the candidate genes. The positions and heterogeneity of each marker are shown in Table 4.

"Fluorescent labeled primers for the selected markers were obtained from Applied Biosystems (Foster City, CA) or IDT (Coralville, IA) and genotyping was done on an AB 3730 DNA Analyzer (Applied Biosystems, Foster City, CA). Allele calls were reviewed by two experienced technologists and were checked for inheritance and recombination errors using the programs GAS [90] and MERLIN [91]. Any markers with unresolvable genotypes were re-run and re-evaluated or eliminated from the analysis."

For association study:

"We genotyped 53 SNPs covering the candidate genes DCDC2 and KIAA0319 on chromosome 6p22 and the FOXP2 region of chromosome 7. SNPs were selected which tag regions of linkage disequilibrium using the Tagger function on HapMap (URL), along with SNPs selected to replicate previously reported associations and haplotypes with RD. In all, 36 SNPs were genotyped on chromosome six spanning the genes DCDC2, KIAA0319, and TTRAP. On chromosome 7, we genotyped 17 SNPs spanning FOXP2, including the region upstream of the gene. . .Genotyping was done on a Sequenom MassArray iPlex system."

Analysis Methods: 
Linkage analysis:

The authors performed linkage analysis with both quantitative and categorical measures, using MERLIN and verifying the results by running the same quantitative analysis using the DeFries-Fulker Augmented analysis.

Association analysis:

"Only quantitative traits were used in this analysis, and analysis was again done by two methods: QTDT and FBAT. The same quantitative measures were used as in the linkage analyses. "

Other Details: 
Inclusion criteria:

"Probands met four entrance screening criteria. The first was nonverbal intelligence above 85. For children ages 3;6 to 6;11 it was measured with the Columbia Mental Maturity Scales [73] and for children ages 7–17, the performance IQ scales from the Wechsler Intelligence Test for Children [74] were utilized. Parents and children ages 17 years and older were evaluated with the performance scales for the Wechsler Intelligence Test for Adults [75]. Probands met exclusionary criteria for nonverbal intelligence; this requirement was not met for parents and siblings whose intellectual status was an outcome of the study. The second criterion for the probands was normal hearing acuity. The third was no history of neurological disorders or diagnosis of autism. The fourth was intelligible speech sufficient for language transcription and production of target phonemes used in word final morphology, as in “goes” and “talks.” Probands were identified as SLI based on language performance one standard deviation or more below the mean on an age appropriate language test. All probands were screened for articulation to ensure they could produce the phonemes needed for morphological measurement and sufficient intelligibility for reliable spontaneous language transcription. Family members received age appropriate speech, language, and reading assessments. Siblings were recruited from age 2 years to adulthood. Within age levels, all participants received the same assessments. The probands and siblings received multiple times of measurement as part of the longitudinal study. For the phenotyping in this study, the lowest value of each variable of interest was selected. This is in keeping with the methods used in the SLI Consortium studies where past or current language performance was used to identify probands [3]. Further, the lowest performance estimate captures the late talker status of siblings."

Diagnostic criteria:

"Probands were identified as SLI based on language performance one standard deviation or more below the mean on an age appropriate language test."

Tests used:

Woodcock and GORT (reading)
GFTA (articulation)
MLU, TEGI, CTOPP, PPVT and the Omnibus language score ("facets of language").

Associated Markers:
rs6901322  (P = 0.0413)  - Allele: A; FBAT analysis; Peabody Picture Vocabulary Test-Revised or 3rd edition (PPVT)
rs6935076  (P = 0.0263)  - Allele: T; FBAT analysis; age-appropriate Omnibus language test
rs3756821  (P = 0.0426)  - Allele: A; FBAT analysis; age-appropriate Omnibus language test


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Oral reading Rice et al 2009 JSON | XML

Additional Phenotype Details: May be assessed using the Gray Oral Reading Test (GORT)

Basic Study Type:  Linkage and association studies

Study Cohort: 
Summary:

322 subjects (86 probands, 134 siblings, 102 parents and other relatives)

Detail:

Participants "were drawn from an ongoing longitudinal study of Specific Language Impairment. . .There were 86 probands, mean ages 6;1 to 8;10 across variables, ascertained from school speech pathology caseloads followed by assessment to meet the requirements of the study. There were a total of 134 siblings: 77 males, mean age 8;6; 57 females, mean age 8;5. Previous studies report longitudinal outcomes for part of this sample, documenting that the children’s language impairments persist into adolescence [13, 69–72]."

Genotyping Methods: 
For linkage study:

"Several extended families were included, and some phenotypes were available for relatives besides siblings. The pair counts for each phenotype by the type of relative are shown in Table 3, and these data were included in the linkage analyses. . .Well-characterized microsatellite markers in the critical regions of linkage were identified through the NCBI UNISTS website, with intermarker centimorgan distances taken from the Rutgers Combined Linkage-Physical map v2 [89]. Markers were selected to be about 2 cM apart, particularly targeting the candidate genes. The positions and heterogeneity of each marker are shown in Table 4.

"Fluorescent labeled primers for the selected markers were obtained from Applied Biosystems (Foster City, CA) or IDT (Coralville, IA) and genotyping was done on an AB 3730 DNA Analyzer (Applied Biosystems, Foster City, CA). Allele calls were reviewed by two experienced technologists and were checked for inheritance and recombination errors using the programs GAS [90] and MERLIN [91]. Any markers with unresolvable genotypes were re-run and re-evaluated or eliminated from the analysis."

For association study:

"We genotyped 53 SNPs covering the candidate genes DCDC2 and KIAA0319 on chromosome 6p22 and the FOXP2 region of chromosome 7. SNPs were selected which tag regions of linkage disequilibrium using the Tagger function on HapMap (URL), along with SNPs selected to replicate previously reported associations and haplotypes with RD. In all, 36 SNPs were genotyped on chromosome six spanning the genes DCDC2, KIAA0319, and TTRAP. On chromosome 7, we genotyped 17 SNPs spanning FOXP2, including the region upstream of the gene. . .Genotyping was done on a Sequenom MassArray iPlex system."

Analysis Methods: 
Linkage analysis:

The authors performed linkage analysis with both quantitative and categorical measures, using MERLIN and verifying the results by running the same quantitative analysis using the DeFries-Fulker Augmented analysis.

Association analysis:

"Only quantitative traits were used in this analysis, and analysis was again done by two methods: QTDT and FBAT. The same quantitative measures were used as in the linkage analyses. "

Other Details: 
Inclusion criteria:

"Probands met four entrance screening criteria. The first was nonverbal intelligence above 85. For children ages 3;6 to 6;11 it was measured with the Columbia Mental Maturity Scales [73] and for children ages 7–17, the performance IQ scales from the Wechsler Intelligence Test for Children [74] were utilized. Parents and children ages 17 years and older were evaluated with the performance scales for the Wechsler Intelligence Test for Adults [75]. Probands met exclusionary criteria for nonverbal intelligence; this requirement was not met for parents and siblings whose intellectual status was an outcome of the study. The second criterion for the probands was normal hearing acuity. The third was no history of neurological disorders or diagnosis of autism. The fourth was intelligible speech sufficient for language transcription and production of target phonemes used in word final morphology, as in “goes” and “talks.” Probands were identified as SLI based on language performance one standard deviation or more below the mean on an age appropriate language test. All probands were screened for articulation to ensure they could produce the phonemes needed for morphological measurement and sufficient intelligibility for reliable spontaneous language transcription. Family members received age appropriate speech, language, and reading assessments. Siblings were recruited from age 2 years to adulthood. Within age levels, all participants received the same assessments. The probands and siblings received multiple times of measurement as part of the longitudinal study. For the phenotyping in this study, the lowest value of each variable of interest was selected. This is in keeping with the methods used in the SLI Consortium studies where past or current language performance was used to identify probands [3]. Further, the lowest performance estimate captures the late talker status of siblings."

Diagnostic criteria:

"Probands were identified as SLI based on language performance one standard deviation or more below the mean on an age appropriate language test."

Tests used:

Woodcock and GORT (reading)
GFTA (articulation)
MLU, TEGI, CTOPP, PPVT and the Omnibus language score ("facets of language").

Associated Markers:
rs6901322  (P = 0.0470)  - QTDT
rs6935076  (P = 0.0167)  - Allele: T; FBAT
rs3756821  (P = 0.0106)  - Allele: A; FBAT
rs761100  (P = 0.0412)  - Allele: G; FBAT
rs4504469  (P = 0.0400)  - QTDT


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Speech articulation Rice et al 2009 JSON | XML

Additional Phenotype Details: May be tested using the Goldman Fristoe Test of Articulation (GFTA).

Basic Study Type:  Linkage and association studies

Study Cohort: 
Summary:

322 subjects (86 probands, 134 siblings, 102 parents and other relatives)

Detail:

Participants "were drawn from an ongoing longitudinal study of Specific Language Impairment. . .There were 86 probands, mean ages 6;1 to 8;10 across variables, ascertained from school speech pathology caseloads followed by assessment to meet the requirements of the study. There were a total of 134 siblings: 77 males, mean age 8;6; 57 females, mean age 8;5. Previous studies report longitudinal outcomes for part of this sample, documenting that the children’s language impairments persist into adolescence [13, 69–72]."

Genotyping Methods: 
For linkage study:

"Several extended families were included, and some phenotypes were available for relatives besides siblings. The pair counts for each phenotype by the type of relative are shown in Table 3, and these data were included in the linkage analyses. . .Well-characterized microsatellite markers in the critical regions of linkage were identified through the NCBI UNISTS website, with intermarker centimorgan distances taken from the Rutgers Combined Linkage-Physical map v2 [89]. Markers were selected to be about 2 cM apart, particularly targeting the candidate genes. The positions and heterogeneity of each marker are shown in Table 4.

"Fluorescent labeled primers for the selected markers were obtained from Applied Biosystems (Foster City, CA) or IDT (Coralville, IA) and genotyping was done on an AB 3730 DNA Analyzer (Applied Biosystems, Foster City, CA). Allele calls were reviewed by two experienced technologists and were checked for inheritance and recombination errors using the programs GAS [90] and MERLIN [91]. Any markers with unresolvable genotypes were re-run and re-evaluated or eliminated from the analysis."

For association study:

"We genotyped 53 SNPs covering the candidate genes DCDC2 and KIAA0319 on chromosome 6p22 and the FOXP2 region of chromosome 7. SNPs were selected which tag regions of linkage disequilibrium using the Tagger function on HapMap (URL), along with SNPs selected to replicate previously reported associations and haplotypes with RD. In all, 36 SNPs were genotyped on chromosome six spanning the genes DCDC2, KIAA0319, and TTRAP. On chromosome 7, we genotyped 17 SNPs spanning FOXP2, including the region upstream of the gene. . .Genotyping was done on a Sequenom MassArray iPlex system."

Analysis Methods: 
Linkage analysis:

The authors performed linkage analysis with both quantitative and categorical measures, using MERLIN and verifying the results by running the same quantitative analysis using the DeFries-Fulker Augmented analysis.

Association analysis:

"Only quantitative traits were used in this analysis, and analysis was again done by two methods: QTDT and FBAT. The same quantitative measures were used as in the linkage analyses. "

Other Details: 
Inclusion criteria:

"Probands met four entrance screening criteria. The first was nonverbal intelligence above 85. For children ages 3;6 to 6;11 it was measured with the Columbia Mental Maturity Scales [73] and for children ages 7–17, the performance IQ scales from the Wechsler Intelligence Test for Children [74] were utilized. Parents and children ages 17 years and older were evaluated with the performance scales for the Wechsler Intelligence Test for Adults [75]. Probands met exclusionary criteria for nonverbal intelligence; this requirement was not met for parents and siblings whose intellectual status was an outcome of the study. The second criterion for the probands was normal hearing acuity. The third was no history of neurological disorders or diagnosis of autism. The fourth was intelligible speech sufficient for language transcription and production of target phonemes used in word final morphology, as in “goes” and “talks.” Probands were identified as SLI based on language performance one standard deviation or more below the mean on an age appropriate language test. All probands were screened for articulation to ensure they could produce the phonemes needed for morphological measurement and sufficient intelligibility for reliable spontaneous language transcription. Family members received age appropriate speech, language, and reading assessments. Siblings were recruited from age 2 years to adulthood. Within age levels, all participants received the same assessments. The probands and siblings received multiple times of measurement as part of the longitudinal study. For the phenotyping in this study, the lowest value of each variable of interest was selected. This is in keeping with the methods used in the SLI Consortium studies where past or current language performance was used to identify probands [3]. Further, the lowest performance estimate captures the late talker status of siblings."

Diagnostic criteria:

"Probands were identified as SLI based on language performance one standard deviation or more below the mean on an age appropriate language test."

Tests used:

Woodcock and GORT (reading)
GFTA (articulation)
MLU, TEGI, CTOPP, PPVT and the Omnibus language score ("facets of language").

Associated Markers:
rs6901322  (P = 0.0203, 0.0124)  - QTDT and FBAT, respectively
rs807530  (P = 0.0343)  - QTDT
rs807533  (P = 0.0187)  - FBAT
rs2760179  (P = 0.0141)  - QTDT


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Reading comprehension Newbury et al 2011 JSON | XML

Additional Phenotype Details: May be assessed with the reading comprehension test from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993).

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs2143340  (P = 0.0188)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Receptive language skills Newbury et al 2011 JSON | XML

Additional Phenotype Details: May be assessed using the receptive language scale of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992).

Reference

Semel EM, Wiig EH, Secord W (1992) Clinical evaluation of language fundamentals—revised. Phychological Corporation, San Antonio.

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs3212236  (P = 0.0038)
rs2143340  (P = 0.0084)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Spelling ability Newbury et al 2011 JSON | XML

Additional Phenotype Details: Possible measures include the spelling subtests of any of a number of intelligence and literacy tests, e.g.:

Peabody Individual Achievement Test (PIAT)
Western Australian Literacy and Numeracy Assessment (WALNA)
Wide Range Achievement Test (WRAT)

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs3212236  (P = 0.0495)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Single-word reading Newbury et al 2011 JSON | XML

Additional Phenotype Details: Possible measures include the single-word reading subtest of Wechsler Objective Reading Dimensions
(WORD), and the British Ability Scales (BAS) test of single-word reading.


References

Elliot CD, Murray DJ, Pearson LS (1979) The British ability scales. NFER, Slough, UK

Rust J, Golombok S, Trickey G (1993) Wechsler objective reading dimensions. Psychological Corporation, Sidcup.

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs3212236  (P = 0.0223)
rs2143340  (P = 0.0130)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Spelling ability Newbury et al 2011 JSON | XML

Additional Phenotype Details: Possible measures include the spelling subtests of any of a number of intelligence and literacy tests, e.g.:

Peabody Individual Achievement Test (PIAT)
Western Australian Literacy and Numeracy Assessment (WALNA)
Wide Range Achievement Test (WRAT)

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs9461045  (P = 0.0256)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Expressive language skills Newbury et al 2011 JSON | XML

Additional Phenotype Details: May be assessed using the expressive language scale of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992).

Reference

Semel EM, Wiig EH, Secord W (1992) Clinical evaluation of language fundamentals—revised. Phychological Corporation, San Antonio.

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs6935076  (P = 0.0073)
rs761100  (P = 0.0349)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Irregular-word reading Newbury et al 2011 JSON | XML

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs4504469  (P = 0.0174)
rs9461045  (P = 0.0254)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 SLI Susceptibility to Specific Language Impairment Newbury et al 2011 JSON | XML

Additional Phenotype Details: 
Specific Language Impairment may be diagnosed based on an expressive and/or receptive language score less than a certain number of SDs (e.g. 1.5) below the mean for the individual's age on a test such as the Clinical Evaluation of Language Fundamentals (CELF). Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion. See Tomblin et al 1996 for a specific system for diagnosing SLI.


References

Semel EM, Wiig EH, Secord W (1992) Clinical evaluation of language fundamentals—revised. Phychological Corporation, San Antonio.

Tomblin JB, Records NL, Zhang X (1996) A system for the diagnosis of specific language impairment in kindergarten children. J Speech Hear Res 39:1284–1294.

Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs2143340  (P = 0.036)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Orthographic coding in forced word choice Newbury et al 2011 JSON | XML

Additional Phenotype Details: assessed using a forced word choice test

Basic Study Type:  Association study

Study Cohort: 
Summary: SLI cohort consists of 780 individuals from 181 families. Dyslexia cohort consists of 634 probands and siblings from 264 families. For case-control analysis, also had 331 unrelated dyslexic individuals.


SLI cohort

"The SLI families used in this study were provided by the SLI Consortium (SLIC) cohort which has previously been described in detail (SLIC 2002, 2004; Falcaro et al. 2008). This family-based sample included 780 individuals from 181 2-generation families and had a child male:female ratio of 1.6:1. . . The samples were assessed by one of five separate centres across the UK and were derived from both clinical and epidemiological studies. The Newcomen Centre at Guy’s Hospital, London, the Cambridge Language and Speech Project (CLASP—(Burden et al. 1996)), the Child Life and Health Department at the University of Edinburgh (Clark et al. 2007), the Department of Child Health at the University of Aberdeen and the Manchester Language Study (Conti-Ramsden and Botting 1999; Conti-Ramsden et al. 1997)."

Dyslexia cohort

"The collection of families used for quantitative trait association has been extensively described previously (Francks et al. 2004). Briefly, all probands and siblings from our complete Oxford set of 264 unrelated nuclear families (a total of 634 siblings with a male:female ratio of 1.5:1), were identified from the dyslexia clinic at the Royal Berkshire Hospital (Reading, U.K)."

For case-control analyses only: "In addition to the dyslexia family-based sample, we analysed a collection of 331 UK unrelated cases which have not been investigated in previous studies for any of the loci under study here. These samples were recruited through the Dyslexia Research Centre clinics in Oxford and Reading, and the Aston Dyslexia and Development clinic in Birmingham. The cases are between 8 and 18.5 years of age, have a BAS2 single-word reading score B100 (at chronological age) and >1.5 SDs below that predicted by their IQ scores. Since these individuals were collected as a case cohort, we did not investigate quantitative measures for them."

Genotyping Methods: 
"In total 31 SNPs were genotyped. These included four SNPs from MRPL19/C2ORF3, four SNPs from DCDC2, six SNPs from KIAA0319, two SNPs from DYX1C1, five SNPs from CNTNAP2, five SNPs from CMIP and five SNPs from ATP2C2 (Table 1). SLI and dyslexia individuals were genotyped in separate experiments, therefore the SNP data quality varied between these cohorts. In addition, control data were not available for all SNPs, therefore case–control analyses were not performed for all 31 SNPs. SNPs were genotyped using the Sequenom iPLEX assay. Genotypes in the form of marker clusters were checked manually in the MassArray TyperAnalyser software. Any SNP with a success rate of <80% or any SNP that showed consistent bad inheritances (>10 errors after data clean-up) within each independent cohort were removed from the association analyses. Probabilities of Hardy–Weinberg Equilibrium (HWE) were calculated for all SNPs within PEDSTATS (Wigginton and Abecasis 2005) and any SNP with a HWE-P of <0.0001 was excluded."

Analysis Methods: 
- QTDT (Quantitative Transmission Disequilibrium Test) performed independently within SLI and dyslexia families; IBD (Identity By Descent) calculated in MERLIN

- Also conducted case-control analyses (allelic association test, within PLINK)

Other Details: 
SLI cohort, diagnostic criteria:

"All families were ascertained on the basis of a single proband with receptive and/or expressive language skills, either currently or in the past, more than 1.5 SD below the normative mean for their chronological age."

SLI cohort, other inclusion criteria

"Any child reported to have a nonverbal IQ of below 80 was excluded from the study. Other exclusion criteria included monozygotic twinning, chronic illness requiring multiple hospital visits or admissions, deafness, a clinical diagnosis of autism, English being a second language, children with known neurological disorders and children under local authority care."

SLI cohort, phenotypic measures:

"Language abilities of all available SLIC children (regardless of language ability) were assessed using the expressive (ELS, n = 392) and receptive (RLS, n = 392) scales of the Clinical Evaluation of Language Fundamentals (CELF-R) battery (Semel et al. 1992) and a 28-item nonword repetition (NWR, n = 451) test (Gathercole et al. 1994). Reading aptitude was measured using the single word reading (Read, n = 312), single-word spelling (Spell, n = 310) and reading comprehension (Comp, n = 276) tests from the Wechsler Objective Reading Dimensions (WORD) (Rust et al. 1993). Verbal and non-verbal IQ were examined, primarily for exclusion purposes, using the Wechsler Intelligence Scales for Children (WISC-III) (Wechsler 1992). Due to the age constraints of standardised tests, all phenotypic data were collected for children only. All scores were normalised for age effects. Due to logistical constraints, the reading tests were only performed for a subset of SLI individuals."

Dyslexia cohort, diagnostic criteria:

"Families were ascertained if the proband had a British Abilities Scales (BAS) single-word reading score >2 SDs below that predicted by their intelligence quotient (IQ) and if at least one other sibling had a history of reading problems. These criteria identified some probands with high IQ scores and BAS reading scores within the ‘normal’ range. Therefore, after collecting 173 UK families the ascertainment conditions were changed such that the only required criterion was that the probands’ difference in their BAS single-word reading score had to be >=1 SD below the population mean for their age (and not IQ), along with an IQ >= 90."


Dyslexia cohort, other inclusion criteria
"Probands were excluded if they had been diagnosed with co-occuring developmental disorders such as SLI, autism or attention deficit-hyperactivity disorder (ADHD)."

Dyslexia cohort, phenotypic measures

"We administered a battery of psychometric tests to all probands and siblings in each family, and we age-adjusted and standardized their scores against a normative control data set, as described elsewhere (Marlow et al. 2001; Fisher et al. 2002). These included measures of single-word reading ability (READ; n = 634) and spelling ability (SPELL; n = 603) from the British Ability Scales (BAS) (Elliot et al. 1983) or Wide Range Achievement Test (WRAT-R) for children older than 14.5 (Jastak and Wilkson 1984), phonological decoding ability (PD; n = 629) (use of letter to sound relationship rules to read pseudowords) (Castles and Coltheart 1993), phonemic awareness (PA; n = 591) (awareness of the phonemic structure of language; test which required the individuals to orally move phonemes either within the same word or between words, also known as ‘‘spoonerism’’) (Gallagher and Frederickson 1995), orthographic coding (OC-irreg; n = 625) (the ability to read real words that do not follow conventional spelling to sound rules e.g. yacht) (Castles and Coltheart 1993) and orthographic coding assessed by a forced word choice test (OC-choice; n = 548) (identification of a correctly spelt word from two phonologically equivalent options, e.g. rane vs rain) between (Olson et al. 1994). Tests of verbal and non-verbal reasoning were assessed using the BAS similarities (SIM; n = 620) or BAS matrices (MAT; n = 588) tests respectively (Elliot et al. 1983). The Similarities sub-scale of the Wechsler Adult Intelligence Scales (WAIS), which is analogous to the BAS similarities test, was used when age was >17.5 years (Wechsler 1981). Note that the measures of reading and spelling were derived from different tests of the same constructs to those utilized in the SLI cohort."

Associated Markers:
rs2143340  (P = 0.0403)
rs9461045  (P = 0.0307)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Susceptibility to developmental dyslexia Scerri et al 2011 JSON | XML

Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

References (fourth editions of these tests are also now available):

Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

Associated Markers:
rs6935076  (P = 0.026; 0.011)  - P-values for case-control analysis for dyslexia only and dyslexia and dyslexia + comorbid case samples, respectively
rs9461045  (P = 0.026; 0.035)  - P-values for case-control analysis for dyslexia only and dyslexia and dyslexia + comorbid case samples, respectively


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Single-word reading Scerri et al 2011 JSON | XML

Additional Phenotype Details: Possible measures include the single-word reading subtest of Wechsler Objective Reading Dimensions
(WORD), and the British Ability Scales (BAS) test of single-word reading.


References

Elliot CD, Murray DJ, Pearson LS (1979) The British ability scales. NFER, Slough, UK

Rust J, Golombok S, Trickey G (1993) Wechsler objective reading dimensions. Psychological Corporation, Sidcup.

Associated Markers:
rs2143340  (P = 0.001)  - association found in F1 sample (mixed dyslexia, SLI, ADHD, unaffected); F2 sample (excludes pure SLI or pure ADHD); F3 sample (removed dyslexia cases with comorbidity); F4 sample (unaffected only)


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Susceptibility to developmental dyslexia Zou et al 2012 JSON | XML

Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

References (fourth editions of these tests are also now available):

Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

Basic Study Type:  Meta-analysis of case–control and transmission/disequilibrium test (TDT) studies

Study Cohort: 
"734 cases, 1067 controls and 586 families concerning the -3G>A in DYX1C1 and 869 cases, 999 controls and 347 families concerning the 931C>T in KIAA0319 to examine the associations between these two variants and dyslexia risk."

Analysis Methods: 
"Data from each case–control and TDT studies were extracted to summarize two-by-two tables and two-by-one tables, respectively. According to the method described by Kazeem and Farrall [2005] ORs, 95%CIs and standard errors (SEs)were calculated for individual study on the basis of allele data. The between-study heterogeneity was assessed by X2-based Cochran’s Q-statistic test and the heterogeneity was considered present when P<0.10. Data from studies were pooled by a fixed-effects model when heterogeneity was negligible; otherwise, the random-effects model was applied. For the synthesis of case–control and TDT studies, Kazeem and Farrall [2005] outlined a methodological improvement for achieving integration by a fixed-effects approach, and then Nicodemus subsequently extended this method to the random-effects model [Nicodemus, 2008]. After obtaining the estimate of logarithm of the OR and its associated SE in each case–control or TDT study, the estimate of pooled OR and its associated SE can be calculated by a weighted analysis method [Hedges and Olkin, 1985]. The Catmap software for this method can be downloaded from the comprehensive R network http://www.r-project.org [Nicodemus, 2008]. Stratified analyses were conducted, if feasible, according to ethnicity, study design, sample size and publication year. Publication bias was assessed by Egger’s test [Egger et al., 1997]. In addition, sensitivity analysis was performed to evaluate the influence of each study on the overall estimate. All statistical analyses were carried out in Catmap software V1.6, and all P values are two-tailed with a significant level at 0.05."

Other Details: 
"Identification and Eligibility of Relevant Studies

"We conducted an electronic search for relevant literatures published before March 29, 2012 from MEDLINE, EMBASE, and ISI Web of Science with the combinations of the following terms ‘‘DYX1C1, or EKN1, or KIAA0319,’’ ‘‘polymorphism or variant’’ and ‘‘dyslexia or reading disability.’’ To expand the coverage of our searches, we further performed searches in Chinese Biomedical (CBM) database with the translation of all English searching items. Referencesof the retrieved articles and reviews were also checked for additional studies.
"We included all the case–control and TDT studies with human subjects that investigated the association between DYX1C1 or KIAA0319 polymorphism and dyslexia risk with genotyping data for at least one of the two polymorphisms, 3G>A in DYX1C1 and 931C>T in KIAA0319 in all languages. Animal studies, reviews, simply commentaries, case reports, unpublished reports and studies not offering necessary data to calculate odds ratios (ORs) and 95% confidence intervals (CIs) were excluded. Studies with overlapping data were carefully considered and the report with complete design or larger sample size was finally selected. Additionally, if studies applied case–control and TDT designs in the same or overlapping probands, the design with larger sample size was ultimately included."

Associated Markers:
rs4504469  (P = 0.021)  - Fixed effects model across studies


Comments


Post a new comment

Sign In or Register to post a comment.

9856 KIAA0319 6p22.3-6p22.2 Dyslexia Susceptibility to developmental dyslexia Venkatesh et al 2013 JSON | XML

Additional Phenotype Details: Typical diagnostic criteria for dyslexia include remarkable deviation from population mean on age-appropriate standardized reading and spelling tests, such as those in the Wechsler intelligence tests. Reading tests may include oral reading and non-word reading.

Usually, a Performance Intelligence Quotient (PIQ) of at least 70 or 80 on the age-appropriate Weschler test is also a criterion.

References (fourth editions of these tests are also now available):

Wechsler D. 1991. Wechsler intelligence scale for children- third edition (WISC-III). San Antonio: The Psychological Corporation.

Wechsler D. 1997. Wechsler Adult Intelligence Scale-III (WAIS-III). San Antonio: The Psychological Corporation.

Associated Markers:
rs4504469 


Comments


Post a new comment

Sign In or Register to post a comment.